Incidental Mutation 'PIT4472001:Tpgs2'
ID555891
Institutional Source Beutler Lab
Gene Symbol Tpgs2
Ensembl Gene ENSMUSG00000024269
Gene Nametubulin polyglutamylase complex subunit 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4472001 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location25127223-25169007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25168595 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 5 (T5M)
Ref Sequence ENSEMBL: ENSMUSP00000111484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036619] [ENSMUST00000097643] [ENSMUST00000115817] [ENSMUST00000148255] [ENSMUST00000159605] [ENSMUST00000160530] [ENSMUST00000165400]
Predicted Effect probably benign
Transcript: ENSMUST00000036619
SMART Domains Protein: ENSMUSP00000046227
Gene: ENSMUSG00000033632

DomainStartEndE-ValueType
Pfam:KIAA1328 92 414 1.4e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097643
SMART Domains Protein: ENSMUSP00000095248
Gene: ENSMUSG00000033632

DomainStartEndE-ValueType
Pfam:KIAA1328 92 414 2.5e-154 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115817
AA Change: T5M

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111484
Gene: ENSMUSG00000024269
AA Change: T5M

DomainStartEndE-ValueType
SMI1_KNR4 43 187 1.04e-3 SMART
low complexity region 253 264 N/A INTRINSIC
low complexity region 271 293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148255
AA Change: T5M

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000122538
Gene: ENSMUSG00000024269
AA Change: T5M

DomainStartEndE-ValueType
SMI1_KNR4 43 187 1.04e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159605
Predicted Effect probably benign
Transcript: ENSMUST00000160530
Predicted Effect probably benign
Transcript: ENSMUST00000165400
SMART Domains Protein: ENSMUSP00000128437
Gene: ENSMUSG00000033632

DomainStartEndE-ValueType
Pfam:KIAA1328 92 414 1.6e-160 PFAM
Coding Region Coverage
  • 1x: 93.7%
  • 3x: 90.8%
  • 10x: 84.2%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the neuronal polyglutamylase complex, which plays a role in post-translational addition of glutamate residues to C-terminal tubulin tails. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
Bcas3 A G 11: 85,531,900 I532V probably damaging Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cd300e T A 11: 115,054,510 I153F possibly damaging Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cpvl A T 6: 53,896,479 F424Y possibly damaging Het
Cxcl16 C T 11: 70,458,799 G80R probably damaging Het
Cyp2g1 T C 7: 26,814,194 V186A probably benign Het
Cyp4f15 T A 17: 32,702,824 M490K probably damaging Het
D630045J12Rik A T 6: 38,178,839 V1160D probably damaging Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fgf5 T A 5: 98,261,979 V129E probably damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gcnt2 G A 13: 40,917,937 V19M probably benign Het
Gga1 C A 15: 78,893,636 A595D probably damaging Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Gskip C T 12: 105,684,862 probably benign Het
Ighv1-72 A G 12: 115,758,000 V112A probably damaging Het
Krt16 T A 11: 100,247,906 T185S probably benign Het
Lama1 T C 17: 67,764,704 V862A Het
Lats2 A C 14: 57,699,357 Y558* probably null Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mnx1 T C 5: 29,474,107 E326G unknown Het
Mtmr10 A G 7: 64,333,358 E471G probably benign Het
Olfr488 C T 7: 108,256,103 V12M possibly damaging Het
Otog G A 7: 46,295,849 V2177M probably damaging Het
Ovgp1 A G 3: 105,986,990 E693G unknown Het
Pclo T C 5: 14,713,168 M600T possibly damaging Het
Pdgfra T A 5: 75,180,246 M622K probably damaging Het
Pdxdc1 A G 16: 13,845,345 L428P probably damaging Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Podnl1 G A 8: 84,127,848 V150M Het
Pou4f3 A G 18: 42,394,652 M4V probably benign Het
Ppp1r13b G A 12: 111,832,640 R864C probably damaging Het
R3hdm4 A G 10: 79,913,555 probably null Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Sptb G A 12: 76,620,686 T879M probably damaging Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Strip1 G A 3: 107,628,170 A79V probably benign Het
Trim34a T A 7: 104,247,948 L73Q probably damaging Het
Trpv4 T A 5: 114,626,923 T677S probably damaging Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Other mutations in Tpgs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Tpgs2 APN 18 25140580 missense possibly damaging 0.93
IGL02184:Tpgs2 APN 18 25140573 missense probably damaging 1.00
IGL02234:Tpgs2 APN 18 25149244 critical splice acceptor site probably null
IGL02747:Tpgs2 APN 18 25139145 intron probably benign
PIT4466001:Tpgs2 UTSW 18 25168595 missense possibly damaging 0.77
R0004:Tpgs2 UTSW 18 25158238 splice site probably benign
R0139:Tpgs2 UTSW 18 25149185 missense probably damaging 1.00
R0898:Tpgs2 UTSW 18 25149150 missense probably damaging 1.00
R1415:Tpgs2 UTSW 18 25168553 missense probably damaging 1.00
R1590:Tpgs2 UTSW 18 25140573 missense probably damaging 1.00
R1974:Tpgs2 UTSW 18 25140536 missense probably damaging 1.00
R2144:Tpgs2 UTSW 18 25168541 missense possibly damaging 0.93
R4811:Tpgs2 UTSW 18 25129840 intron probably benign
R4851:Tpgs2 UTSW 18 25151248 missense possibly damaging 0.94
R6386:Tpgs2 UTSW 18 25139024 missense possibly damaging 0.74
R6564:Tpgs2 UTSW 18 25158287 missense probably damaging 0.99
R6788:Tpgs2 UTSW 18 25129870 missense probably benign 0.04
R7112:Tpgs2 UTSW 18 25149137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTCCTGGCCTGGATAGATTG -3'
(R):5'- CCTCAGGCGCTGAAAACTAC -3'

Sequencing Primer
(F):5'- TGGATAGATTGCCGCCTCC -3'
(R):5'- GGCGCTGAAAACTACAACTC -3'
Posted On2019-06-07