Incidental Mutation 'PIT4458001:Btnl4'
ID555937
Institutional Source Beutler Lab
Gene Symbol Btnl4
Ensembl Gene ENSMUSG00000058435
Gene Namebutyrophilin-like 4
SynonymsBtnl4, EG632126, NG11
Accession Numbers

Genbank: NM_001039241; MGI: 1932036

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4458001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34469042-34475937 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34474268 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 58 (M58L)
Ref Sequence ENSEMBL: ENSMUSP00000064161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065841]
Predicted Effect probably benign
Transcript: ENSMUST00000065841
AA Change: M58L

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064161
Gene: ENSMUSG00000058435
AA Change: M58L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 145 2.44e-7 SMART
Pfam:C2-set_2 150 233 3.6e-6 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 316 328 N/A INTRINSIC
PRY 341 386 7.43e-2 SMART
SPRY 387 510 4.67e-20 SMART
low complexity region 514 554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,298,304 V2684L probably benign Het
Adamts9 T A 6: 92,889,905 I718F probably damaging Het
Adcyap1r1 A G 6: 55,478,082 D110G probably benign Het
Adgrd1 G A 5: 129,131,577 G281D probably damaging Het
Afg1l A T 10: 42,454,370 C100* probably null Het
Atp2a2 G A 5: 122,457,309 Q993* probably null Het
Baz1a A G 12: 54,930,310 M389T probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cpeb1 A T 7: 81,348,432 F533Y probably damaging Het
Ctnna1 T A 18: 35,175,126 N166K possibly damaging Het
Ecsit T C 9: 22,076,284 H153R probably damaging Het
Gbp8 T C 5: 105,015,089 K480E probably benign Het
Glyat A T 19: 12,648,009 T66S probably benign Het
Gm1110 T C 9: 26,880,828 Q632R probably benign Het
Gm12185 C T 11: 48,907,911 R585Q probably damaging Het
Gm17669 TAA TAAA 18: 67,562,749 probably null Het
Gm7489 A C 15: 53,885,799 E89A unknown Het
Grb7 C T 11: 98,453,829 Q353* probably null Het
Ifi207 G A 1: 173,735,172 T136I unknown Het
Ighv3-1 T C 12: 113,964,604 Y45C probably benign Het
Ing5 A G 1: 93,811,946 M92V possibly damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kdm6b A T 11: 69,399,952 D1630E unknown Het
Lmo7 C T 14: 101,887,487 Q583* probably null Het
Lrrc37a T C 11: 103,504,512 D29G probably benign Het
Mpdz G T 4: 81,419,026 A10D probably damaging Het
Myh4 A G 11: 67,240,995 M94V possibly damaging Het
Nectin2 A C 7: 19,738,327 L46V probably benign Het
Nynrin A T 14: 55,863,968 T365S probably benign Het
Olfr1225 A T 2: 89,170,633 I193K probably benign Het
Pde4b A C 4: 102,602,678 E570A probably damaging Het
Phf3 T C 1: 30,816,541 H988R probably damaging Het
Ppfia2 A G 10: 106,927,847 K1234E probably benign Het
Prl7c1 A T 13: 27,773,758 M233K probably benign Het
Prp2 C T 6: 132,600,547 P266S unknown Het
Ralgds T C 2: 28,542,474 L160P probably damaging Het
Rasa1 A T 13: 85,227,118 M664K possibly damaging Het
Ryr2 T C 13: 11,555,448 T4930A probably benign Het
Senp8 T C 9: 59,737,480 Y131C probably damaging Het
Sp100 A G 1: 85,708,116 I547M probably benign Het
Spata20 A G 11: 94,484,608 M120T probably damaging Het
Spata31 A G 13: 64,921,850 H604R probably benign Het
Sycp1 A T 3: 102,934,833 S53T probably benign Het
Tgm1 T C 14: 55,712,565 D62G unknown Het
Trpm1 G C 7: 64,268,561 E1434Q possibly damaging Het
Tshb A T 3: 102,778,164 Y50N probably damaging Het
Wdr17 A T 8: 54,673,579 Y413* probably null Het
Zdhhc16 G A 19: 41,937,770 G55R possibly damaging Het
Other mutations in Btnl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02451:Btnl4 APN 17 34475927 missense probably benign 0.34
FR4589:Btnl4 UTSW 17 34472636 missense probably benign 0.30
N/A:Btnl4 UTSW 17 34472586 splice site probably benign
R0601:Btnl4 UTSW 17 34469311 missense probably benign 0.07
R0718:Btnl4 UTSW 17 34469634 missense probably benign 0.44
R1163:Btnl4 UTSW 17 34470075 missense possibly damaging 0.65
R1823:Btnl4 UTSW 17 34475852 critical splice donor site probably null
R1954:Btnl4 UTSW 17 34472930 missense possibly damaging 0.87
R1955:Btnl4 UTSW 17 34472930 missense possibly damaging 0.87
R4649:Btnl4 UTSW 17 34472628 missense probably benign 0.12
R4651:Btnl4 UTSW 17 34472628 missense probably benign 0.12
R4681:Btnl4 UTSW 17 34470101 splice site probably null
R6081:Btnl4 UTSW 17 34474236 missense probably damaging 1.00
R6770:Btnl4 UTSW 17 34474037 missense probably benign 0.26
R6859:Btnl4 UTSW 17 34469379 missense probably damaging 1.00
R6885:Btnl4 UTSW 17 34472945 missense probably benign 0.00
R7265:Btnl4 UTSW 17 34475894 missense probably benign 0.00
R7316:Btnl4 UTSW 17 34469057 missense probably benign 0.06
R7454:Btnl4 UTSW 17 34472374 missense probably benign
X0023:Btnl4 UTSW 17 34475930 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ATCCCACTATCTGATGCCTGG -3'
(R):5'- AGAGCAACTCCATCTATCCCTTG -3'

Sequencing Primer
(F):5'- TGGACATTTAGGATCCTCACAGCAG -3'
(R):5'- TGCTTTCTGCTGGGATGATATTCCC -3'
Posted On2019-06-07