Incidental Mutation 'PIT4504001:Bank1'
ID555999
Institutional Source Beutler Lab
Gene Symbol Bank1
Ensembl Gene ENSMUSG00000037922
Gene NameB cell scaffold protein with ankyrin repeats 1
SynonymsA530094C12Rik
Accession Numbers

Genbank: NM_001033350.2

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #PIT4504001 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location136053363-136326066 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 136100419 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 485 (D485Y)
Ref Sequence ENSEMBL: ENSMUSP00000035484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041577] [ENSMUST00000196159] [ENSMUST00000198206]
Predicted Effect probably damaging
Transcript: ENSMUST00000041577
AA Change: D485Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035484
Gene: ENSMUSG00000037922
AA Change: D485Y

DomainStartEndE-ValueType
DBB 197 327 1.24e-62 SMART
Blast:ANK 341 371 7e-12 BLAST
SCOP:d1awcb_ 344 398 2e-4 SMART
Blast:ANK 377 407 2e-6 BLAST
coiled coil region 465 486 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
coiled coil region 560 583 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196159
AA Change: D352Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142366
Gene: ENSMUSG00000037922
AA Change: D352Y

DomainStartEndE-ValueType
DBB 64 194 1.24e-62 SMART
Blast:ANK 208 238 6e-12 BLAST
SCOP:d1awcb_ 211 265 1e-4 SMART
Blast:ANK 244 274 3e-6 BLAST
coiled coil region 332 353 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
coiled coil region 427 450 N/A INTRINSIC
low complexity region 476 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198206
SMART Domains Protein: ENSMUSP00000142996
Gene: ENSMUSG00000037922

DomainStartEndE-ValueType
DBB 64 194 5.9e-67 SMART
Blast:ANK 208 238 5e-12 BLAST
SCOP:d1awcb_ 211 265 1e-4 SMART
Blast:ANK 244 274 2e-6 BLAST
low complexity region 300 313 N/A INTRINSIC
coiled coil region 359 382 N/A INTRINSIC
low complexity region 408 421 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a B-cell-specific scaffold protein that functions in B-cell receptor-induced calcium mobilization from intracellular stores. This protein can also promote Lyn-mediated tyrosine phosphorylation of inositol 1,4,5-trisphosphate receptors. Polymorphisms in this gene are associated with susceptibility to systemic lupus erythematosus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased germinal center formation and IgM production in response to T-dependent antigens, and show enhanced CD40-mediated B cell proliferative and survival responses. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,717,192 C970* probably null Het
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Arid5a T C 1: 36,317,625 I116T probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Cox10 C T 11: 63,964,216 C413Y possibly damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hcn1 A G 13: 117,975,875 T792A possibly damaging Het
Hemgn T C 4: 46,395,863 N458D probably benign Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hfe2 A T 3: 96,528,497 D357V probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Il33 A T 19: 29,952,739 H78L probably benign Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mllt3 A C 4: 87,774,087 F546L probably damaging Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Osbpl11 T A 16: 33,234,494 V649D probably benign Het
Pdlim2 G T 14: 70,166,130 P278T probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pmpcb G T 5: 21,743,390 R223L probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Tshz2 T C 2: 169,886,051 F856L probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp455 A G 13: 67,198,621 D32G probably damaging Het
Zfp512 T A 5: 31,476,881 probably null Het
Zfr A G 15: 12,166,158 E838G possibly damaging Het
Other mutations in Bank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Bank1 APN 3 136247634 missense probably damaging 0.99
IGL03088:Bank1 APN 3 136093362 missense probably damaging 0.98
IGL03190:Bank1 APN 3 136100424 missense probably damaging 1.00
I2289:Bank1 UTSW 3 136054418 missense probably damaging 1.00
R0193:Bank1 UTSW 3 136066518 splice site probably benign
R0423:Bank1 UTSW 3 136284017 missense possibly damaging 0.68
R0518:Bank1 UTSW 3 136213942 missense probably damaging 1.00
R0521:Bank1 UTSW 3 136213942 missense probably damaging 1.00
R0587:Bank1 UTSW 3 136214037 splice site probably benign
R0628:Bank1 UTSW 3 136066390 missense probably damaging 1.00
R0723:Bank1 UTSW 3 136054403 splice site probably null
R0811:Bank1 UTSW 3 136093366 missense probably damaging 1.00
R0812:Bank1 UTSW 3 136093366 missense probably damaging 1.00
R1101:Bank1 UTSW 3 136283864 missense probably benign 0.08
R1446:Bank1 UTSW 3 136064143 missense probably damaging 1.00
R1564:Bank1 UTSW 3 136213841 nonsense probably null
R1636:Bank1 UTSW 3 136083226 missense probably damaging 1.00
R1667:Bank1 UTSW 3 136093296 missense probably damaging 1.00
R1751:Bank1 UTSW 3 136234614 missense probably benign 0.00
R1751:Bank1 UTSW 3 136254937 missense probably benign 0.00
R2023:Bank1 UTSW 3 136325918 missense probably benign 0.02
R2851:Bank1 UTSW 3 136242940 missense possibly damaging 0.92
R2852:Bank1 UTSW 3 136242940 missense possibly damaging 0.92
R3411:Bank1 UTSW 3 136247773 splice site probably benign
R4422:Bank1 UTSW 3 136083211 missense probably damaging 0.99
R4499:Bank1 UTSW 3 136284243 missense probably benign 0.44
R4693:Bank1 UTSW 3 136247676 missense probably damaging 0.99
R4744:Bank1 UTSW 3 136247689 missense probably benign 0.12
R4791:Bank1 UTSW 3 136254929 missense probably benign 0.00
R4911:Bank1 UTSW 3 136284243 missense probably benign 0.44
R4967:Bank1 UTSW 3 136066373 missense probably damaging 1.00
R4979:Bank1 UTSW 3 136254901 missense probably damaging 0.99
R5119:Bank1 UTSW 3 136234682 missense possibly damaging 0.67
R5284:Bank1 UTSW 3 136064154 missense probably damaging 1.00
R5547:Bank1 UTSW 3 136066349 missense probably damaging 0.99
R5610:Bank1 UTSW 3 136066387 missense probably damaging 1.00
R6012:Bank1 UTSW 3 136213837 missense probably benign 0.44
R6087:Bank1 UTSW 3 136066429 missense probably damaging 1.00
R6753:Bank1 UTSW 3 136093308 missense probably damaging 1.00
R6764:Bank1 UTSW 3 136242940 missense probably damaging 0.97
R6861:Bank1 UTSW 3 136255003 missense probably benign 0.33
R7013:Bank1 UTSW 3 136100509 missense possibly damaging 0.74
R7436:Bank1 UTSW 3 136055800 missense possibly damaging 0.76
V1662:Bank1 UTSW 3 136054418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTGTAGAAGCCTTGGAAC -3'
(R):5'- ACCTTCCAGACAGTGTAAGTG -3'

Sequencing Primer
(F):5'- CAAACTGTTTCTCTGCAATTTTTAGC -3'
(R):5'- CCTTCCAGACAGTGTAAGTGAAACTG -3'
Posted On2019-06-07