Incidental Mutation 'PIT4498001:St8sia1'
ID556064
Institutional Source Beutler Lab
Gene Symbol St8sia1
Ensembl Gene ENSMUSG00000030283
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
SynonymsST8Sia I, Siat8, Siat8a, GD3S, GD3 synthase, 9330109E03Rik, alpha-2,8-sialyltransferase
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #PIT4498001 (G1)
Quality Score200.009
Status Not validated
Chromosome6
Chromosomal Location142821545-142964452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142914122 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 94 (T94A)
Ref Sequence ENSEMBL: ENSMUSP00000032421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032421] [ENSMUST00000205149]
Predicted Effect probably damaging
Transcript: ENSMUST00000032421
AA Change: T94A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032421
Gene: ENSMUSG00000030283
AA Change: T94A

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Pfam:Glyco_transf_29 90 344 8.1e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205149
SMART Domains Protein: ENSMUSP00000145148
Gene: ENSMUSG00000030283

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
transmembrane domain 76 95 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.0%
  • 10x: 86.1%
  • 20x: 75.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gangliosides are membrane-bound glycosphingolipids containing sialic acid. Ganglioside GD3 is known to be important for cell adhesion and growth of cultured malignant cells. The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to GM3 to produce gangliosides GD3 and GT3. The encoded protein may be found in the Golgi apparatus and is a member of glycosyltransferase family 29. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted allele are behaviorally normal with no signs of aberrant brain histology or demyelination. Homozygotes for a knock-out allele are behaviorally intact with normal nervous tissue morphology and sensitivity to Fas-mediated apoptosis but show impaired repair of damaged nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 T C 19: 40,574,356 N191S probably benign Het
Cacnb2 T A 2: 14,874,819 L84* probably null Het
Cdhr2 C T 13: 54,718,239 T284M possibly damaging Het
D430042O09Rik A G 7: 125,813,596 T371A probably benign Het
Defb45 T C 2: 152,596,474 probably benign Het
Dkk3 C T 7: 112,119,472 V236M probably benign Het
Dscc1 A T 15: 55,082,315 V328D probably benign Het
Epha3 T C 16: 63,552,526 Y938C probably damaging Het
Erc1 A T 6: 119,779,491 F435I possibly damaging Het
Fbxl5 T C 5: 43,750,981 Y626C possibly damaging Het
Fmn2 A G 1: 174,612,604 R1196G probably damaging Het
Gabrr1 C T 4: 33,160,225 S303F probably damaging Het
Ggt1 T C 10: 75,578,855 V169A possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm13084 T C 4: 143,812,836 E29G possibly damaging Het
Gm3182 T A 14: 4,481,832 C9S probably damaging Het
Gpr88 A C 3: 116,252,615 S16A unknown Het
Kalrn A T 16: 34,031,582 M2076K possibly damaging Het
Kcnd3 T C 3: 105,658,709 I402T probably damaging Het
Mink1 A G 11: 70,598,888 D57G probably benign Het
Ncl T C 1: 86,351,440 T584A possibly damaging Het
Nfx1 A T 4: 40,977,244 Q306L probably benign Het
Ogdh A T 11: 6,340,504 D374V probably benign Het
Olfr1167 T A 2: 88,149,915 T35S probably benign Het
Pak7 T A 2: 136,083,291 H697L probably damaging Het
Pappa T C 4: 65,316,232 C1425R probably damaging Het
Rab3gap2 T A 1: 185,281,685 I1196N probably damaging Het
Ralyl A T 3: 14,107,239 D56V probably damaging Het
Scin C T 12: 40,069,447 probably null Het
Slc25a19 T C 11: 115,623,955 I69V possibly damaging Het
Slc8a1 G T 17: 81,648,840 Y256* probably null Het
Smyd1 T C 6: 71,219,288 H372R probably benign Het
Stard9 T A 2: 120,697,435 M1391K possibly damaging Het
Tlr9 G A 9: 106,223,522 R4H probably benign Het
Trim50 A G 5: 135,353,477 D61G probably damaging Het
Ttn G A 2: 76,766,951 P19873S probably damaging Het
Vmn1r228 G T 17: 20,776,510 H249N probably benign Het
Vmn2r108 C T 17: 20,463,017 G642S probably damaging Het
Wdr27 A G 17: 14,934,569 S29P probably benign Het
Zan A G 5: 137,417,036 probably null Het
Other mutations in St8sia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02081:St8sia1 APN 6 142829227 missense probably benign 0.00
IGL02138:St8sia1 APN 6 142963778 utr 5 prime probably benign
IGL02419:St8sia1 APN 6 142828935 missense probably damaging 1.00
IGL03407:St8sia1 APN 6 142914049 missense possibly damaging 0.80
PIT4453001:St8sia1 UTSW 6 142829252 nonsense probably null
R0167:St8sia1 UTSW 6 142914181 splice site probably benign
R0690:St8sia1 UTSW 6 142829254 missense probably damaging 1.00
R1727:St8sia1 UTSW 6 142876727 missense probably damaging 0.99
R1743:St8sia1 UTSW 6 142829016 missense probably damaging 1.00
R1937:St8sia1 UTSW 6 142963672 missense probably damaging 1.00
R2923:St8sia1 UTSW 6 142829237 missense probably damaging 1.00
R2983:St8sia1 UTSW 6 142963629 missense probably damaging 0.99
R3824:St8sia1 UTSW 6 142829025 missense probably damaging 1.00
R4803:St8sia1 UTSW 6 142867923 missense probably benign 0.04
R4844:St8sia1 UTSW 6 142829270 missense possibly damaging 0.82
R4865:St8sia1 UTSW 6 142829070 missense probably damaging 1.00
R4886:St8sia1 UTSW 6 142914134 missense probably damaging 0.99
R5170:St8sia1 UTSW 6 142963708 missense probably damaging 0.99
R5519:St8sia1 UTSW 6 142963561 missense probably damaging 0.99
R5783:St8sia1 UTSW 6 142963614 missense possibly damaging 0.83
R6713:St8sia1 UTSW 6 142829282 splice site probably null
R7017:St8sia1 UTSW 6 142867906 missense probably damaging 0.98
R7144:St8sia1 UTSW 6 142876669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCCTCAAAGCAGGAAAC -3'
(R):5'- ATCTGCTCTGTGGAGTCTGC -3'

Sequencing Primer
(F):5'- CCCAGTGGGCTAGCAGAG -3'
(R):5'- TCTGCAGAGTGAGCTGGCAC -3'
Posted On2019-06-07