Incidental Mutation 'PIT4498001:Slc25a19'
ID556071
Institutional Source Beutler Lab
Gene Symbol Slc25a19
Ensembl Gene ENSMUSG00000020744
Gene Namesolute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19
Synonyms2900089E13Rik, DNC, MUP1, TPC
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4498001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location115614178-115628295 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115623955 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 69 (I69V)
Ref Sequence ENSEMBL: ENSMUSP00000021089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021089] [ENSMUST00000106503] [ENSMUST00000135552] [ENSMUST00000141614] [ENSMUST00000154623] [ENSMUST00000155709] [ENSMUST00000178003]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021089
AA Change: I69V

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021089
Gene: ENSMUSG00000020744
AA Change: I69V

DomainStartEndE-ValueType
Pfam:Mito_carr 12 111 5.7e-20 PFAM
Pfam:Mito_carr 114 205 5.3e-24 PFAM
Pfam:Mito_carr 212 313 5.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106503
AA Change: I69V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102112
Gene: ENSMUSG00000020744
AA Change: I69V

DomainStartEndE-ValueType
Pfam:Mito_carr 11 111 1.7e-22 PFAM
Pfam:Mito_carr 114 172 9.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135552
SMART Domains Protein: ENSMUSP00000114566
Gene: ENSMUSG00000020744

DomainStartEndE-ValueType
Pfam:Mito_carr 31 122 1.1e-25 PFAM
Pfam:Mito_carr 129 226 4.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141614
Predicted Effect probably benign
Transcript: ENSMUST00000154623
Predicted Effect probably benign
Transcript: ENSMUST00000155709
Predicted Effect possibly damaging
Transcript: ENSMUST00000178003
AA Change: I69V

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137534
Gene: ENSMUSG00000020744
AA Change: I69V

DomainStartEndE-ValueType
Pfam:Mito_carr 11 111 1.1e-21 PFAM
Pfam:Mito_carr 114 205 7e-25 PFAM
Pfam:Mito_carr 212 313 1e-24 PFAM
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.0%
  • 10x: 86.1%
  • 20x: 75.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that is a member of the solute carrier family. Although this protein was initially thought to be the mitochondrial deoxynucleotide carrier involved in the uptake of deoxynucleotides into the matrix of the mitochondria, further studies have demonstrated that this protein instead functions as the mitochondrial thiamine pyrophosphate carrier, which transports thiamine pyrophosphates into mitochondria. Mutations in this gene cause microcephaly, Amish type, a metabolic disease that results in severe congenital microcephaly, severe 2-ketoglutaric aciduria, and death within the first year. Multiple alternatively spliced variants, encoding the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality by E12, neural tube closure defects resulting in exencephaly and microcephaly, growth arrest, anemia, elevated alpha-ketoglutarate in amniotic fluid, and reduced thiamine pyrophosphate content in mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 T C 19: 40,574,356 N191S probably benign Het
Cacnb2 T A 2: 14,874,819 L84* probably null Het
Cdhr2 C T 13: 54,718,239 T284M possibly damaging Het
D430042O09Rik A G 7: 125,813,596 T371A probably benign Het
Defb45 T C 2: 152,596,474 probably benign Het
Dkk3 C T 7: 112,119,472 V236M probably benign Het
Dscc1 A T 15: 55,082,315 V328D probably benign Het
Epha3 T C 16: 63,552,526 Y938C probably damaging Het
Erc1 A T 6: 119,779,491 F435I possibly damaging Het
Fbxl5 T C 5: 43,750,981 Y626C possibly damaging Het
Fmn2 A G 1: 174,612,604 R1196G probably damaging Het
Gabrr1 C T 4: 33,160,225 S303F probably damaging Het
Ggt1 T C 10: 75,578,855 V169A possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm13084 T C 4: 143,812,836 E29G possibly damaging Het
Gm3182 T A 14: 4,481,832 C9S probably damaging Het
Gpr88 A C 3: 116,252,615 S16A unknown Het
Kalrn A T 16: 34,031,582 M2076K possibly damaging Het
Kcnd3 T C 3: 105,658,709 I402T probably damaging Het
Mink1 A G 11: 70,598,888 D57G probably benign Het
Ncl T C 1: 86,351,440 T584A possibly damaging Het
Nfx1 A T 4: 40,977,244 Q306L probably benign Het
Ogdh A T 11: 6,340,504 D374V probably benign Het
Olfr1167 T A 2: 88,149,915 T35S probably benign Het
Pak7 T A 2: 136,083,291 H697L probably damaging Het
Pappa T C 4: 65,316,232 C1425R probably damaging Het
Rab3gap2 T A 1: 185,281,685 I1196N probably damaging Het
Ralyl A T 3: 14,107,239 D56V probably damaging Het
Scin C T 12: 40,069,447 probably null Het
Slc8a1 G T 17: 81,648,840 Y256* probably null Het
Smyd1 T C 6: 71,219,288 H372R probably benign Het
St8sia1 T C 6: 142,914,122 T94A probably damaging Het
Stard9 T A 2: 120,697,435 M1391K possibly damaging Het
Tlr9 G A 9: 106,223,522 R4H probably benign Het
Trim50 A G 5: 135,353,477 D61G probably damaging Het
Ttn G A 2: 76,766,951 P19873S probably damaging Het
Vmn1r228 G T 17: 20,776,510 H249N probably benign Het
Vmn2r108 C T 17: 20,463,017 G642S probably damaging Het
Wdr27 A G 17: 14,934,569 S29P probably benign Het
Zan A G 5: 137,417,036 probably null Het
Other mutations in Slc25a19
AlleleSourceChrCoordTypePredicted EffectPPH Score
Baggins UTSW 11 115617560 missense possibly damaging 0.91
R0335:Slc25a19 UTSW 11 115624206 missense probably damaging 1.00
R0398:Slc25a19 UTSW 11 115617575 missense probably damaging 1.00
R0454:Slc25a19 UTSW 11 115617597 nonsense probably null
R1614:Slc25a19 UTSW 11 115616623 nonsense probably null
R3775:Slc25a19 UTSW 11 115615459 missense probably damaging 1.00
R3776:Slc25a19 UTSW 11 115615459 missense probably damaging 1.00
R5000:Slc25a19 UTSW 11 115616671 intron probably null
R5593:Slc25a19 UTSW 11 115616592 missense probably damaging 1.00
R5738:Slc25a19 UTSW 11 115624234 missense probably benign 0.24
R6167:Slc25a19 UTSW 11 115615551 missense probably benign 0.14
R6306:Slc25a19 UTSW 11 115617560 missense possibly damaging 0.91
R7014:Slc25a19 UTSW 11 115620966 missense probably damaging 1.00
R7161:Slc25a19 UTSW 11 115616547 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ATCTCCCATGAAGGCAAACTG -3'
(R):5'- TTAGTCCCAGCAAAGGCAGTC -3'

Sequencing Primer
(F):5'- AACTGGCAGAGTGGGGCTTG -3'
(R):5'- GGCAGTCCCCAAAACTTAGAATTCTG -3'
Posted On2019-06-07