Incidental Mutation 'PIT4498001:Wdr27'
ID556078
Institutional Source Beutler Lab
Gene Symbol Wdr27
Ensembl Gene ENSMUSG00000046991
Gene NameWD repeat domain 27
Synonyms0610012K18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #PIT4498001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location14818519-14943158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14934569 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 29 (S29P)
Ref Sequence ENSEMBL: ENSMUSP00000126736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170386] [ENSMUST00000228330] [ENSMUST00000232147]
Predicted Effect probably benign
Transcript: ENSMUST00000170386
AA Change: S29P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000126736
Gene: ENSMUSG00000046991
AA Change: S29P

DomainStartEndE-ValueType
WD40 59 99 4.79e-1 SMART
WD40 114 149 6.36e1 SMART
WD40 152 192 3.93e-7 SMART
WD40 195 235 2.38e1 SMART
low complexity region 473 492 N/A INTRINSIC
WD40 498 539 1.48e1 SMART
WD40 542 581 5.26e-8 SMART
WD40 642 684 2.97e0 SMART
WD40 687 737 7.64e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228330
AA Change: S29P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000232147
AA Change: S29P

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.0%
  • 10x: 86.1%
  • 20x: 75.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD repeats. Proteins with these repeats may form scaffolds for protein-protein interaction and play key roles in cell signalling. Alternative splicing results in multiple transcript variants, but the full-length structure of some of these variants cannot be determined. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 T C 19: 40,574,356 N191S probably benign Het
Cacnb2 T A 2: 14,874,819 L84* probably null Het
Cdhr2 C T 13: 54,718,239 T284M possibly damaging Het
D430042O09Rik A G 7: 125,813,596 T371A probably benign Het
Defb45 T C 2: 152,596,474 probably benign Het
Dkk3 C T 7: 112,119,472 V236M probably benign Het
Dscc1 A T 15: 55,082,315 V328D probably benign Het
Epha3 T C 16: 63,552,526 Y938C probably damaging Het
Erc1 A T 6: 119,779,491 F435I possibly damaging Het
Fbxl5 T C 5: 43,750,981 Y626C possibly damaging Het
Fmn2 A G 1: 174,612,604 R1196G probably damaging Het
Gabrr1 C T 4: 33,160,225 S303F probably damaging Het
Ggt1 T C 10: 75,578,855 V169A possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm13084 T C 4: 143,812,836 E29G possibly damaging Het
Gm3182 T A 14: 4,481,832 C9S probably damaging Het
Gpr88 A C 3: 116,252,615 S16A unknown Het
Kalrn A T 16: 34,031,582 M2076K possibly damaging Het
Kcnd3 T C 3: 105,658,709 I402T probably damaging Het
Mink1 A G 11: 70,598,888 D57G probably benign Het
Ncl T C 1: 86,351,440 T584A possibly damaging Het
Nfx1 A T 4: 40,977,244 Q306L probably benign Het
Ogdh A T 11: 6,340,504 D374V probably benign Het
Olfr1167 T A 2: 88,149,915 T35S probably benign Het
Pak7 T A 2: 136,083,291 H697L probably damaging Het
Pappa T C 4: 65,316,232 C1425R probably damaging Het
Rab3gap2 T A 1: 185,281,685 I1196N probably damaging Het
Ralyl A T 3: 14,107,239 D56V probably damaging Het
Scin C T 12: 40,069,447 probably null Het
Slc25a19 T C 11: 115,623,955 I69V possibly damaging Het
Slc8a1 G T 17: 81,648,840 Y256* probably null Het
Smyd1 T C 6: 71,219,288 H372R probably benign Het
St8sia1 T C 6: 142,914,122 T94A probably damaging Het
Stard9 T A 2: 120,697,435 M1391K possibly damaging Het
Tlr9 G A 9: 106,223,522 R4H probably benign Het
Trim50 A G 5: 135,353,477 D61G probably damaging Het
Ttn G A 2: 76,766,951 P19873S probably damaging Het
Vmn1r228 G T 17: 20,776,510 H249N probably benign Het
Vmn2r108 C T 17: 20,463,017 G642S probably damaging Het
Zan A G 5: 137,417,036 probably null Het
Other mutations in Wdr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Wdr27 APN 17 14928310 nonsense probably null
IGL00973:Wdr27 APN 17 14913878 missense probably benign 0.01
IGL01012:Wdr27 APN 17 14926247 missense probably damaging 1.00
IGL01924:Wdr27 APN 17 14917226 missense probably damaging 0.99
IGL02044:Wdr27 APN 17 14901769 missense possibly damaging 0.72
IGL02198:Wdr27 APN 17 14908598 missense possibly damaging 0.52
IGL02430:Wdr27 APN 17 14901800 missense probably damaging 0.98
IGL02496:Wdr27 APN 17 14892431 splice site probably benign
IGL02552:Wdr27 APN 17 14926191 missense probably damaging 1.00
IGL02590:Wdr27 APN 17 14917779 missense possibly damaging 0.93
IGL02892:Wdr27 APN 17 14876176 missense possibly damaging 0.95
IGL02957:Wdr27 APN 17 14910110 splice site probably benign
IGL03295:Wdr27 APN 17 14934575 missense possibly damaging 0.71
R0329:Wdr27 UTSW 17 14934459 splice site probably benign
R0671:Wdr27 UTSW 17 14928396 missense probably benign 0.04
R1166:Wdr27 UTSW 17 14892471 missense probably damaging 1.00
R1308:Wdr27 UTSW 17 14928384 missense probably damaging 0.98
R1652:Wdr27 UTSW 17 14917270 missense probably benign 0.01
R1771:Wdr27 UTSW 17 14892441 missense probably damaging 1.00
R1966:Wdr27 UTSW 17 14934599 missense possibly damaging 0.86
R2106:Wdr27 UTSW 17 14920854 missense probably benign 0.44
R2131:Wdr27 UTSW 17 14928332 missense probably damaging 1.00
R3803:Wdr27 UTSW 17 14918109 missense probably benign 0.01
R4335:Wdr27 UTSW 17 14920756 splice site probably null
R4577:Wdr27 UTSW 17 14903462 missense probably benign 0.00
R4787:Wdr27 UTSW 17 14932554 missense possibly damaging 0.86
R4853:Wdr27 UTSW 17 14917213 splice site probably null
R4922:Wdr27 UTSW 17 14920754 splice site probably null
R4951:Wdr27 UTSW 17 14876133 missense probably damaging 0.99
R5784:Wdr27 UTSW 17 14926233 missense probably damaging 1.00
R5809:Wdr27 UTSW 17 14883669 missense probably damaging 1.00
R6128:Wdr27 UTSW 17 14932534 nonsense probably null
R6584:Wdr27 UTSW 17 14901769 missense probably damaging 1.00
R6705:Wdr27 UTSW 17 14934590 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACAGGTGACTCCATGAG -3'
(R):5'- GTACACTCATGCTCATGGTGATG -3'

Sequencing Primer
(F):5'- CTCCATGAGAGGGAATGTTTCTAG -3'
(R):5'- CCGTGTATTGCACATGGT -3'
Posted On2019-06-07