Incidental Mutation 'PIT4486001:Kdm5b'
ID556084
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Namelysine (K)-specific demethylase 5B
SynonymsJarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #PIT4486001 (G1)
Quality Score184.009
Status Not validated
Chromosome1
Chromosomal Location134560171-134635285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134628685 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1370 (L1370Q)
Ref Sequence ENSEMBL: ENSMUSP00000038138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
Predicted Effect probably damaging
Transcript: ENSMUST00000047714
AA Change: L1370Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: L1370Q

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112198
AA Change: L1370Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: L1370Q

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134620955 missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134621986 missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134602540 missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134617968 missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134600727 missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134624931 missense probably benign 0.09
IGL02592:Kdm5b APN 1 134624853 missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134604485 missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134588773 splice site probably benign
IGL03036:Kdm5b APN 1 134608937 missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134587979 missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134627317 missense probably benign
IGL03342:Kdm5b APN 1 134602576 missense probably benign 0.00
IGL03388:Kdm5b APN 1 134627322 missense probably benign
amaryllis UTSW 1 134609061 critical splice donor site probably null
R0233:Kdm5b UTSW 1 134604634 splice site probably benign
R0334:Kdm5b UTSW 1 134604522 missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134621023 critical splice donor site probably null
R0505:Kdm5b UTSW 1 134602571 missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134618033 missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134588904 missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134600637 missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134613991 missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134599091 missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134613254 missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134630550 missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134624897 missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134624853 missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134602481 missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134597576 splice site probably benign
R1721:Kdm5b UTSW 1 134613181 splice site probably benign
R1741:Kdm5b UTSW 1 134618017 missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134604467 nonsense probably null
R1820:Kdm5b UTSW 1 134597670 missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134624994 missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134613873 splice site probably null
R2056:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2059:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2405:Kdm5b UTSW 1 134609016 missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134587977 missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134613345 missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134630542 missense probably benign
R3803:Kdm5b UTSW 1 134615941 missense probably benign 0.07
R3980:Kdm5b UTSW 1 134619670 missense probably benign 0.11
R3983:Kdm5b UTSW 1 134631304 missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134627329 missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134625161 missense probably benign 0.01
R4701:Kdm5b UTSW 1 134606012 intron probably benign
R4791:Kdm5b UTSW 1 134630800 missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134593315 splice site probably null
R4924:Kdm5b UTSW 1 134631351 missense probably benign 0.00
R5135:Kdm5b UTSW 1 134588746 intron probably benign
R5248:Kdm5b UTSW 1 134620997 missense probably benign 0.11
R5290:Kdm5b UTSW 1 134622099 splice site probably null
R5358:Kdm5b UTSW 1 134607694 nonsense probably null
R5388:Kdm5b UTSW 1 134608897 nonsense probably null
R5396:Kdm5b UTSW 1 134622098 splice site probably null
R5397:Kdm5b UTSW 1 134622098 splice site probably null
R5398:Kdm5b UTSW 1 134622098 splice site probably null
R5399:Kdm5b UTSW 1 134622098 splice site probably null
R5529:Kdm5b UTSW 1 134588003 missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134631241 missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134599073 missense probably benign 0.01
R5663:Kdm5b UTSW 1 134630635 missense probably benign
R5822:Kdm5b UTSW 1 134588773 splice site probably benign
R6226:Kdm5b UTSW 1 134608878 missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134599207 missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134613269 missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134609061 critical splice donor site probably null
R7132:Kdm5b UTSW 1 134599106 missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134624759 missense probably benign
R7258:Kdm5b UTSW 1 134621021 missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134560439 missense probably damaging 1.00
X0063:Kdm5b UTSW 1 134588876 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AATCTGCGTTAGCCCTGCTC -3'
(R):5'- CAGACAGTTTGTGTGCTCTCG -3'

Sequencing Primer
(F):5'- CTCTGGTTTAGGGGCATTAAGAC -3'
(R):5'- TGCTCTCGTGGCTCAAAGAC -3'
Posted On2019-06-07