Incidental Mutation 'PIT4494001:Medag'
ID556147
Institutional Source Beutler Lab
Gene Symbol Medag
Ensembl Gene ENSMUSG00000029659
Gene Namemesenteric estrogen dependent adipogenesis
SynonymsMEDA-4, 6330406I15Rik
Accession Numbers

Genbank: NM_027519; MGI: 1917967

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4494001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location149411749-149431723 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149427300 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 194 (Y194C)
Ref Sequence ENSEMBL: ENSMUSP00000090798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093110] [ENSMUST00000201083]
Predicted Effect probably damaging
Transcript: ENSMUST00000093110
AA Change: Y194C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090798
Gene: ENSMUSG00000029659
AA Change: Y194C

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201083
AA Change: Y80C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.1%
  • 10x: 85.6%
  • 20x: 73.9%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik T C 4: 123,860,905 I204T probably benign Het
Acnat2 T C 4: 49,383,133 E140G probably benign Het
Arhgef10l T C 4: 140,565,211 E413G probably damaging Het
Atg9a A T 1: 75,187,953 C122* probably null Het
Birc6 T C 17: 74,626,980 Y2544H probably damaging Het
C3 G A 17: 57,209,263 T1383I probably benign Het
Cd2ap C T 17: 42,852,367 probably null Het
Cdhr1 T C 14: 37,082,856 T466A probably benign Het
Cdhr2 G T 13: 54,718,442 probably null Het
Eppk1 T A 15: 76,106,072 Q2203L probably benign Het
F10 T C 8: 13,053,423 L281P probably damaging Het
Farp2 A G 1: 93,617,594 T825A probably damaging Het
Fbxw27 T C 9: 109,772,110 E314G probably benign Het
Foxred1 T C 9: 35,209,059 E173G possibly damaging Het
Gm4847 T C 1: 166,640,018 E203G probably damaging Het
Gpat2 G A 2: 127,433,880 R526H probably benign Het
Grin2a T C 16: 9,585,096 Y842C probably damaging Het
Hyal4 T C 6: 24,755,834 V17A probably benign Het
Igkv4-68 T C 6: 69,305,107 T27A probably damaging Het
Loxhd1 A T 18: 77,441,768 N2036Y probably damaging Het
Lrp5 T C 19: 3,610,091 Y991C probably damaging Het
Lrp6 T C 6: 134,479,778 Y841C probably damaging Het
Mynn C T 3: 30,607,722 R318* probably null Het
Notch1 C T 2: 26,466,473 V1711M probably damaging Het
Nsun2 T C 13: 69,618,192 probably null Het
Pex7 A G 10: 19,894,723 probably null Het
Pkd1 A G 17: 24,577,801 T2417A probably damaging Het
Pknox2 A G 9: 36,954,691 probably null Het
Plekha4 T C 7: 45,548,079 S522P probably damaging Het
Ptcd1 A T 5: 145,155,358 S310R probably benign Het
Rap2a A G 14: 120,478,907 T61A possibly damaging Het
Ryr3 G T 2: 112,841,876 L1437M probably damaging Het
Slc25a40 T G 5: 8,440,737 I95S probably damaging Het
Srbd1 C T 17: 86,142,359 probably null Het
Tox4 C T 14: 52,291,803 T407I possibly damaging Het
Vmn1r8 A G 6: 57,036,727 I254M probably benign Het
Wiz G A 17: 32,361,931 A182V probably damaging Het
Zfp60 T C 7: 27,748,701 S265P probably damaging Het
Other mutations in Medag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Medag APN 5 149429907 missense probably benign 0.23
IGL02531:Medag APN 5 149422151 missense probably benign 0.00
IGL02817:Medag APN 5 149427038 nonsense probably null
3-1:Medag UTSW 5 149427285 missense probably benign 0.03
R1074:Medag UTSW 5 149412209 missense probably benign 0.10
R1654:Medag UTSW 5 149422135 missense probably damaging 1.00
R1858:Medag UTSW 5 149429794 missense probably damaging 0.99
R1999:Medag UTSW 5 149427252 missense probably damaging 1.00
R3840:Medag UTSW 5 149427423 missense probably damaging 1.00
R3841:Medag UTSW 5 149427423 missense probably damaging 1.00
R4272:Medag UTSW 5 149422163 missense probably damaging 1.00
R4642:Medag UTSW 5 149411979 start codon destroyed probably null 0.85
R5218:Medag UTSW 5 149422254 splice site probably benign
R5593:Medag UTSW 5 149426950 missense probably benign 0.00
R5700:Medag UTSW 5 149422217 missense probably benign 0.00
R6043:Medag UTSW 5 149422207 missense probably benign 0.14
R7009:Medag UTSW 5 149427243 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CAGTGTTCCCCTGCAGACATTG -3'
(R):5'- CCCTGAGAGTTTATGACCTACCTC -3'

Sequencing Primer
(F):5'- CCTGCAGACATTGAAGTTGC -3'
(R):5'- ATGACCTACCTCTAGATGTGACG -3'
Posted On2019-06-07