Incidental Mutation 'PIT4494001:Eppk1'
ID556164
Institutional Source Beutler Lab
Gene Symbol Eppk1
Ensembl Gene ENSMUSG00000115388
Gene Nameepiplakin 1
SynonymsEPIPL1, EPPK
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #PIT4494001 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76101481-76120195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76106072 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 2203 (Q2203L)
Ref Sequence ENSEMBL: ENSMUSP00000154609 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000226781
AA Change: Q2203L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.1%
  • 10x: 85.6%
  • 20x: 73.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the plakin family of proteins, which play a role in the organization of cytoskeletal architecture. This family member is composed of several highly homologous plakin repeats. It may function to maintain the integrity of keratin intermediate filament networks in epithelial cells. Studies of the orthologous mouse protein suggest that it accelerates keratinocyte migration during wound healing. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a null allele exhbit normal skin morphology. Mice homozygous for a reporter knock-in allele exhibit enhanced wound healing associated with increased keratinocyte migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik T C 4: 123,860,905 I204T probably benign Het
Acnat2 T C 4: 49,383,133 E140G probably benign Het
Arhgef10l T C 4: 140,565,211 E413G probably damaging Het
Atg9a A T 1: 75,187,953 C122* probably null Het
Birc6 T C 17: 74,626,980 Y2544H probably damaging Het
C3 G A 17: 57,209,263 T1383I probably benign Het
Cd2ap C T 17: 42,852,367 probably null Het
Cdhr1 T C 14: 37,082,856 T466A probably benign Het
Cdhr2 G T 13: 54,718,442 probably null Het
F10 T C 8: 13,053,423 L281P probably damaging Het
Farp2 A G 1: 93,617,594 T825A probably damaging Het
Fbxw27 T C 9: 109,772,110 E314G probably benign Het
Foxred1 T C 9: 35,209,059 E173G possibly damaging Het
Gm4847 T C 1: 166,640,018 E203G probably damaging Het
Gpat2 G A 2: 127,433,880 R526H probably benign Het
Grin2a T C 16: 9,585,096 Y842C probably damaging Het
Hyal4 T C 6: 24,755,834 V17A probably benign Het
Igkv4-68 T C 6: 69,305,107 T27A probably damaging Het
Loxhd1 A T 18: 77,441,768 N2036Y probably damaging Het
Lrp5 T C 19: 3,610,091 Y991C probably damaging Het
Lrp6 T C 6: 134,479,778 Y841C probably damaging Het
Medag A G 5: 149,427,300 Y194C probably damaging Het
Mynn C T 3: 30,607,722 R318* probably null Het
Notch1 C T 2: 26,466,473 V1711M probably damaging Het
Nsun2 T C 13: 69,618,192 probably null Het
Pex7 A G 10: 19,894,723 probably null Het
Pkd1 A G 17: 24,577,801 T2417A probably damaging Het
Pknox2 A G 9: 36,954,691 probably null Het
Plekha4 T C 7: 45,548,079 S522P probably damaging Het
Ptcd1 A T 5: 145,155,358 S310R probably benign Het
Rap2a A G 14: 120,478,907 T61A possibly damaging Het
Ryr3 G T 2: 112,841,876 L1437M probably damaging Het
Slc25a40 T G 5: 8,440,737 I95S probably damaging Het
Srbd1 C T 17: 86,142,359 probably null Het
Tox4 C T 14: 52,291,803 T407I possibly damaging Het
Vmn1r8 A G 6: 57,036,727 I254M probably benign Het
Wiz G A 17: 32,361,931 A182V probably damaging Het
Zfp60 T C 7: 27,748,701 S265P probably damaging Het
Other mutations in Eppk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT1430001:Eppk1 UTSW 15 76105236 missense probably benign 0.00
R6898:Eppk1 UTSW 15 76111926 missense probably benign 0.07
R6981:Eppk1 UTSW 15 76111037 missense probably benign 0.03
R6999:Eppk1 UTSW 15 76109223 missense probably benign 0.03
R7162:Eppk1 UTSW 15 76106609 missense possibly damaging 0.83
R7169:Eppk1 UTSW 15 76105914 missense probably benign 0.05
R7352:Eppk1 UTSW 15 76106418 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGGGTCGATGATGAAGCC -3'
(R):5'- TGCTGAACTCAGAGTATGTGTC -3'

Sequencing Primer
(F):5'- TCGATGATGAAGCCTGTGG -3'
(R):5'- TCAGAGTATGTGTCTGAAGAGAAG -3'
Posted On2019-06-07