Incidental Mutation 'PIT4494001:Srbd1'
ID556171
Institutional Source Beutler Lab
Gene Symbol Srbd1
Ensembl Gene ENSMUSG00000024135
Gene NameS1 RNA binding domain 1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #PIT4494001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location85984665-86145175 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 86142359 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095187]
Predicted Effect probably null
Transcript: ENSMUST00000095187
SMART Domains Protein: ENSMUSP00000092810
Gene: ENSMUSG00000024135

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
low complexity region 104 128 N/A INTRINSIC
Pfam:Tex_N 213 403 2.8e-43 PFAM
YqgFc 532 631 4.1e-32 SMART
Pfam:HHH_7 668 764 1.6e-6 PFAM
Pfam:HHH_3 698 762 4.2e-25 PFAM
S1 903 978 7e-15 SMART
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.1%
  • 10x: 85.6%
  • 20x: 73.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik T C 4: 123,860,905 I204T probably benign Het
Acnat2 T C 4: 49,383,133 E140G probably benign Het
Arhgef10l T C 4: 140,565,211 E413G probably damaging Het
Atg9a A T 1: 75,187,953 C122* probably null Het
Birc6 T C 17: 74,626,980 Y2544H probably damaging Het
C3 G A 17: 57,209,263 T1383I probably benign Het
Cd2ap C T 17: 42,852,367 probably null Het
Cdhr1 T C 14: 37,082,856 T466A probably benign Het
Cdhr2 G T 13: 54,718,442 probably null Het
Eppk1 T A 15: 76,106,072 Q2203L probably benign Het
F10 T C 8: 13,053,423 L281P probably damaging Het
Farp2 A G 1: 93,617,594 T825A probably damaging Het
Fbxw27 T C 9: 109,772,110 E314G probably benign Het
Foxred1 T C 9: 35,209,059 E173G possibly damaging Het
Gm4847 T C 1: 166,640,018 E203G probably damaging Het
Gpat2 G A 2: 127,433,880 R526H probably benign Het
Grin2a T C 16: 9,585,096 Y842C probably damaging Het
Hyal4 T C 6: 24,755,834 V17A probably benign Het
Igkv4-68 T C 6: 69,305,107 T27A probably damaging Het
Loxhd1 A T 18: 77,441,768 N2036Y probably damaging Het
Lrp5 T C 19: 3,610,091 Y991C probably damaging Het
Lrp6 T C 6: 134,479,778 Y841C probably damaging Het
Medag A G 5: 149,427,300 Y194C probably damaging Het
Mynn C T 3: 30,607,722 R318* probably null Het
Notch1 C T 2: 26,466,473 V1711M probably damaging Het
Nsun2 T C 13: 69,618,192 probably null Het
Pex7 A G 10: 19,894,723 probably null Het
Pkd1 A G 17: 24,577,801 T2417A probably damaging Het
Pknox2 A G 9: 36,954,691 probably null Het
Plekha4 T C 7: 45,548,079 S522P probably damaging Het
Ptcd1 A T 5: 145,155,358 S310R probably benign Het
Rap2a A G 14: 120,478,907 T61A possibly damaging Het
Ryr3 G T 2: 112,841,876 L1437M probably damaging Het
Slc25a40 T G 5: 8,440,737 I95S probably damaging Het
Tox4 C T 14: 52,291,803 T407I possibly damaging Het
Vmn1r8 A G 6: 57,036,727 I254M probably benign Het
Wiz G A 17: 32,361,931 A182V probably damaging Het
Zfp60 T C 7: 27,748,701 S265P probably damaging Het
Other mutations in Srbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Srbd1 APN 17 86115209 missense probably damaging 1.00
IGL00988:Srbd1 APN 17 86130270 missense probably damaging 0.96
IGL01111:Srbd1 APN 17 86098533 missense probably benign 0.15
IGL02186:Srbd1 APN 17 86109231 missense probably benign
IGL02233:Srbd1 APN 17 86098622 splice site probably null
IGL02307:Srbd1 APN 17 86126188 missense probably damaging 1.00
IGL02392:Srbd1 APN 17 85988373 missense probably benign 0.34
IGL02831:Srbd1 APN 17 86003871 missense probably damaging 1.00
IGL03299:Srbd1 APN 17 86120659 missense possibly damaging 0.95
PIT4677001:Srbd1 UTSW 17 86115212 nonsense probably null
R0233:Srbd1 UTSW 17 86057745 missense probably damaging 1.00
R0233:Srbd1 UTSW 17 86057745 missense probably damaging 1.00
R0464:Srbd1 UTSW 17 86120002 missense probably damaging 1.00
R0692:Srbd1 UTSW 17 86136460 missense probably benign 0.25
R0771:Srbd1 UTSW 17 86130254 missense probably benign 0.09
R1074:Srbd1 UTSW 17 86003952 missense probably damaging 1.00
R1173:Srbd1 UTSW 17 86098512 missense probably null 1.00
R1446:Srbd1 UTSW 17 86139152 missense probably benign 0.44
R1587:Srbd1 UTSW 17 85985437 missense probably damaging 1.00
R1780:Srbd1 UTSW 17 86057685 missense probably damaging 1.00
R1865:Srbd1 UTSW 17 86115304 splice site probably benign
R1933:Srbd1 UTSW 17 86102893 missense probably damaging 1.00
R1934:Srbd1 UTSW 17 86102893 missense probably damaging 1.00
R2002:Srbd1 UTSW 17 86142400 missense probably benign
R2228:Srbd1 UTSW 17 85985223 missense probably damaging 1.00
R3160:Srbd1 UTSW 17 86130215 missense probably benign 0.03
R3162:Srbd1 UTSW 17 86130215 missense probably benign 0.03
R3162:Srbd1 UTSW 17 86130215 missense probably benign 0.03
R3439:Srbd1 UTSW 17 86057759 missense probably benign 0.01
R3611:Srbd1 UTSW 17 86102927 missense probably benign 0.03
R4255:Srbd1 UTSW 17 86102922 missense possibly damaging 0.80
R4300:Srbd1 UTSW 17 85985204 missense probably damaging 0.98
R4319:Srbd1 UTSW 17 86051150 missense probably damaging 1.00
R4619:Srbd1 UTSW 17 86109265 missense probably benign 0.30
R4620:Srbd1 UTSW 17 86109265 missense probably benign 0.30
R4629:Srbd1 UTSW 17 86120672 missense probably damaging 0.99
R5379:Srbd1 UTSW 17 86001536 missense possibly damaging 0.88
R5469:Srbd1 UTSW 17 86119942 missense possibly damaging 0.77
R5587:Srbd1 UTSW 17 86127801 missense probably damaging 0.99
R5726:Srbd1 UTSW 17 86120729 missense possibly damaging 0.89
R6166:Srbd1 UTSW 17 86099268 missense probably damaging 1.00
R6237:Srbd1 UTSW 17 85985295 missense probably damaging 0.99
R6696:Srbd1 UTSW 17 86139191 missense possibly damaging 0.46
R6971:Srbd1 UTSW 17 86099290 missense possibly damaging 0.79
R6986:Srbd1 UTSW 17 85985222 missense probably damaging 1.00
R7018:Srbd1 UTSW 17 86136415 missense possibly damaging 0.93
R7082:Srbd1 UTSW 17 86057732 missense probably damaging 1.00
R7209:Srbd1 UTSW 17 86001520 missense probably damaging 1.00
R7340:Srbd1 UTSW 17 86136354 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAACAACAGCTTGCCCTCTTTC -3'
(R):5'- TCTGACAGCAGAGCTTTGGAG -3'

Sequencing Primer
(F):5'- CATTACATAACCTGATAGCTGCTTTC -3'
(R):5'- CTGACAGCAGAGCTTTGGAGTATTAG -3'
Posted On2019-06-07