Incidental Mutation 'PIT4514001:Scn7a'
ID556254
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Namesodium channel, voltage-gated, type VII, alpha
SynonymsNaG, Nav2, Nav2.3, Nax, Scn6a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #PIT4514001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location66673425-66784914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66684179 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1084 (F1084L)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
Predicted Effect probably damaging
Transcript: ENSMUST00000042792
AA Change: F1084L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: F1084L

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.2%
  • 20x: 70.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,801,871 H221Q probably benign Het
1700023F06Rik T C 11: 103,201,134 D27G probably benign Het
4930486L24Rik A G 13: 60,853,514 probably null Het
Abcc10 T A 17: 46,305,648 I1247F probably benign Het
Acap3 G A 4: 155,903,378 A524T probably benign Het
Adcy10 T A 1: 165,556,791 N1040K probably benign Het
Adrb2 T C 18: 62,179,727 D9G probably benign Het
Aldh1a7 T C 19: 20,702,240 T391A probably benign Het
Bcam A G 7: 19,764,066 V344A probably benign Het
Birc7 T A 2: 180,931,306 I172N possibly damaging Het
Cfap126 G A 1: 171,125,312 D45N probably damaging Het
Cit G A 5: 115,997,854 probably null Het
Col26a1 A G 5: 136,751,725 V295A probably benign Het
Epha7 C T 4: 28,961,355 Q867* probably null Het
Fn1 A G 1: 71,628,456 S793P probably benign Het
Foxb1 T A 9: 69,760,221 Y9F probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gpc1 T A 1: 92,857,557 M406K probably benign Het
Gsg1 T C 6: 135,237,576 T312A probably benign Het
Hmcn1 T A 1: 150,669,487 I2790F possibly damaging Het
Kcnma1 C T 14: 23,309,035 probably null Het
Lmntd1 AGACTGTAAGTTTCTCAAATGTGTACCTGGA AGA 6: 145,427,253 probably null Het
Mcph1 A G 8: 18,631,890 K348E probably damaging Het
Olfr122 T A 17: 37,771,867 N71K probably damaging Het
Olfr985 T C 9: 40,127,299 I221V probably damaging Het
Pik3cg T A 12: 32,204,903 R362W probably damaging Het
Pkp3 T C 7: 141,089,710 L765P probably damaging Het
Plxna2 A T 1: 194,794,937 I1252F probably benign Het
Prpf8 T C 11: 75,496,355 F1154S possibly damaging Het
Shmt1 G A 11: 60,804,347 S47L probably damaging Het
Snap91 T C 9: 86,879,433 K40R possibly damaging Het
Spag17 A T 3: 100,013,211 T421S possibly damaging Het
Speer4f1 T A 5: 17,478,756 N139K possibly damaging Het
Syne2 T G 12: 76,105,015 N1883K probably damaging Het
Tgfb1i1 C T 7: 128,249,181 R191C probably damaging Het
Tmem39b A C 4: 129,684,497 N310K possibly damaging Het
Trim3 T C 7: 105,618,210 T321A probably benign Het
Vmn2r124 T C 17: 18,073,712 I687T probably benign Het
Zbtb8a T C 4: 129,357,730 D316G probably benign Het
Zfp639 A G 3: 32,520,260 I345V possibly damaging Het
Zfp764 T C 7: 127,404,741 H406R probably benign Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66683327 splice site probably benign
IGL00432:Scn7a APN 2 66741982 nonsense probably null
IGL00720:Scn7a APN 2 66676044 missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00784:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00926:Scn7a APN 2 66684131 missense probably benign 0.06
IGL00963:Scn7a APN 2 66703945 splice site probably benign
IGL01099:Scn7a APN 2 66684238 missense probably damaging 1.00
IGL01326:Scn7a APN 2 66752260 missense probably benign 0.13
IGL01538:Scn7a APN 2 66703852 missense probably benign
IGL01624:Scn7a APN 2 66751925 missense probably benign 0.07
IGL01794:Scn7a APN 2 66675509 missense probably benign
IGL02100:Scn7a APN 2 66675499 makesense probably null
IGL02326:Scn7a APN 2 66700048 missense probably benign 0.00
IGL02472:Scn7a APN 2 66752314 missense probably damaging 1.00
IGL02528:Scn7a APN 2 66700175 missense probably damaging 1.00
IGL02798:Scn7a APN 2 66713875 missense probably benign 0.00
IGL03026:Scn7a APN 2 66676098 missense probably damaging 0.99
IGL03071:Scn7a APN 2 66699947 missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66697816 missense probably benign 0.01
IGL03180:Scn7a APN 2 66676234 missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66675960 missense probably benign 0.00
R0004:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66714037 missense probably benign 0.04
R0230:Scn7a UTSW 2 66726284 missense probably damaging 1.00
R0463:Scn7a UTSW 2 66675740 missense probably benign 0.05
R0846:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66680295 missense probably damaging 0.98
R1282:Scn7a UTSW 2 66700849 missense probably damaging 0.98
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1501:Scn7a UTSW 2 66700163 missense probably benign 0.37
R1672:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66675943 missense probably damaging 0.99
R1712:Scn7a UTSW 2 66705103 missense probably benign 0.05
R1758:Scn7a UTSW 2 66680183 missense probably benign 0.00
R1758:Scn7a UTSW 2 66700887 missense probably damaging 0.97
R1775:Scn7a UTSW 2 66680955 missense probably benign 0.02
R1848:Scn7a UTSW 2 66684013 critical splice donor site probably null
R1851:Scn7a UTSW 2 66680291 missense probably benign
R1919:Scn7a UTSW 2 66699973 missense probably damaging 1.00
R1932:Scn7a UTSW 2 66676102 missense probably damaging 1.00
R1945:Scn7a UTSW 2 66675980 missense probably damaging 1.00
R1970:Scn7a UTSW 2 66684289 missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66683269 missense probably damaging 0.99
R2008:Scn7a UTSW 2 66687747 missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66737436 missense probably damaging 1.00
R2113:Scn7a UTSW 2 66675968 missense probably damaging 1.00
R2128:Scn7a UTSW 2 66697986 missense probably damaging 0.99
R2163:Scn7a UTSW 2 66675956 missense probably damaging 0.97
R2421:Scn7a UTSW 2 66726302 splice site probably benign
R2446:Scn7a UTSW 2 66692658 missense probably damaging 0.98
R2922:Scn7a UTSW 2 66700207 splice site probably benign
R3015:Scn7a UTSW 2 66699896 missense probably benign 0.08
R3034:Scn7a UTSW 2 66682808 missense probably damaging 1.00
R3419:Scn7a UTSW 2 66700895 frame shift probably null
R3429:Scn7a UTSW 2 66700895 frame shift probably null
R3430:Scn7a UTSW 2 66700895 frame shift probably null
R3434:Scn7a UTSW 2 66675503 missense probably benign 0.01
R3803:Scn7a UTSW 2 66680246 nonsense probably null
R3831:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R3833:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R4017:Scn7a UTSW 2 66741985 missense probably damaging 1.00
R4244:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4245:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4276:Scn7a UTSW 2 66684063 missense probably damaging 0.97
R4307:Scn7a UTSW 2 66675755 missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66737471 missense probably damaging 1.00
R4353:Scn7a UTSW 2 66676436 missense probably benign 0.00
R4721:Scn7a UTSW 2 66684185 missense probably damaging 1.00
R4722:Scn7a UTSW 2 66700884 missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66703760 missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66726248 missense probably damaging 1.00
R5362:Scn7a UTSW 2 66699998 missense probably damaging 1.00
R5437:Scn7a UTSW 2 66676346 missense probably damaging 1.00
R5729:Scn7a UTSW 2 66741957 critical splice donor site probably null
R5777:Scn7a UTSW 2 66692569 missense probably damaging 1.00
R5785:Scn7a UTSW 2 66697568 missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66743703 missense probably damaging 0.96
R5830:Scn7a UTSW 2 66714051 nonsense probably null
R5877:Scn7a UTSW 2 66699873 nonsense probably null
R5881:Scn7a UTSW 2 66675526 missense probably benign 0.01
R5967:Scn7a UTSW 2 66675713 missense probably damaging 1.00
R5988:Scn7a UTSW 2 66726214 nonsense probably null
R6077:Scn7a UTSW 2 66697596 missense probably damaging 1.00
R6135:Scn7a UTSW 2 66703900 missense probably benign
R6242:Scn7a UTSW 2 66700766 missense probably benign 0.00
R6264:Scn7a UTSW 2 66675526 missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66700114 missense probably damaging 0.98
R6544:Scn7a UTSW 2 66684100 missense probably damaging 1.00
R6770:Scn7a UTSW 2 66729184 intron probably null
R6997:Scn7a UTSW 2 66703803 missense probably damaging 1.00
R7014:Scn7a UTSW 2 66741959 missense probably null 1.00
R7126:Scn7a UTSW 2 66757286 missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66700193 missense probably benign 0.14
R7176:Scn7a UTSW 2 66676288 missense probably damaging 1.00
R7185:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66757162 missense probably damaging 1.00
X0060:Scn7a UTSW 2 66689682 missense probably benign 0.01
X0066:Scn7a UTSW 2 66680192 missense probably benign
Z1088:Scn7a UTSW 2 66713951 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCACCACTTGGAGTAAAGAAAG -3'
(R):5'- GAGTGACTGTTGAGTTAGTTCCAC -3'

Sequencing Primer
(F):5'- TGGAGTAAAGAAAGAAAACCATTTCC -3'
(R):5'- ACTGTTGAGTTAGTTCCACTTACTTG -3'
Posted On2019-06-07