Incidental Mutation 'PIT4514001:Epha7'
ID556258
Institutional Source Beutler Lab
Gene Symbol Epha7
Ensembl Gene ENSMUSG00000028289
Gene NameEph receptor A7
SynonymsEhk3, Hek11, Cek11, MDK1, Ebk, Mdk1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.626) question?
Stock #PIT4514001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location28813131-28967499 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 28961355 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 867 (Q867*)
Ref Sequence ENSEMBL: ENSMUSP00000029964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029964] [ENSMUST00000108191] [ENSMUST00000108194]
Predicted Effect probably null
Transcript: ENSMUST00000029964
AA Change: Q867*
SMART Domains Protein: ENSMUSP00000029964
Gene: ENSMUSG00000028289
AA Change: Q867*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
Pfam:EphA2_TM 557 630 4.4e-25 PFAM
TyrKc 633 890 8.84e-139 SMART
SAM 920 987 1.26e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108191
AA Change: Q863*
SMART Domains Protein: ENSMUSP00000103826
Gene: ENSMUSG00000028289
AA Change: Q863*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
Pfam:EphA2_TM 556 626 2.9e-23 PFAM
TyrKc 629 886 8.84e-139 SMART
SAM 916 983 1.26e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108194
SMART Domains Protein: ENSMUSP00000103829
Gene: ENSMUSG00000028289

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
transmembrane domain 556 578 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.2%
  • 20x: 70.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Increased expression of this gene is associated with multiple forms of carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Some homozygous mutants display anencephaly. Mutants also exhibit increased proliferation of neural progenitor cells in the lateral ventricle wall of the adult brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,801,871 H221Q probably benign Het
1700023F06Rik T C 11: 103,201,134 D27G probably benign Het
4930486L24Rik A G 13: 60,853,514 probably null Het
Abcc10 T A 17: 46,305,648 I1247F probably benign Het
Acap3 G A 4: 155,903,378 A524T probably benign Het
Adcy10 T A 1: 165,556,791 N1040K probably benign Het
Adrb2 T C 18: 62,179,727 D9G probably benign Het
Aldh1a7 T C 19: 20,702,240 T391A probably benign Het
Bcam A G 7: 19,764,066 V344A probably benign Het
Birc7 T A 2: 180,931,306 I172N possibly damaging Het
Cfap126 G A 1: 171,125,312 D45N probably damaging Het
Cit G A 5: 115,997,854 probably null Het
Col26a1 A G 5: 136,751,725 V295A probably benign Het
Fn1 A G 1: 71,628,456 S793P probably benign Het
Foxb1 T A 9: 69,760,221 Y9F probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gpc1 T A 1: 92,857,557 M406K probably benign Het
Gsg1 T C 6: 135,237,576 T312A probably benign Het
Hmcn1 T A 1: 150,669,487 I2790F possibly damaging Het
Kcnma1 C T 14: 23,309,035 probably null Het
Lmntd1 AGACTGTAAGTTTCTCAAATGTGTACCTGGA AGA 6: 145,427,253 probably null Het
Mcph1 A G 8: 18,631,890 K348E probably damaging Het
Olfr122 T A 17: 37,771,867 N71K probably damaging Het
Olfr985 T C 9: 40,127,299 I221V probably damaging Het
Pik3cg T A 12: 32,204,903 R362W probably damaging Het
Pkp3 T C 7: 141,089,710 L765P probably damaging Het
Plxna2 A T 1: 194,794,937 I1252F probably benign Het
Prpf8 T C 11: 75,496,355 F1154S possibly damaging Het
Scn7a A G 2: 66,684,179 F1084L probably damaging Het
Shmt1 G A 11: 60,804,347 S47L probably damaging Het
Snap91 T C 9: 86,879,433 K40R possibly damaging Het
Spag17 A T 3: 100,013,211 T421S possibly damaging Het
Speer4f1 T A 5: 17,478,756 N139K possibly damaging Het
Syne2 T G 12: 76,105,015 N1883K probably damaging Het
Tgfb1i1 C T 7: 128,249,181 R191C probably damaging Het
Tmem39b A C 4: 129,684,497 N310K possibly damaging Het
Trim3 T C 7: 105,618,210 T321A probably benign Het
Vmn2r124 T C 17: 18,073,712 I687T probably benign Het
Zbtb8a T C 4: 129,357,730 D316G probably benign Het
Zfp639 A G 3: 32,520,260 I345V possibly damaging Het
Zfp764 T C 7: 127,404,741 H406R probably benign Het
Other mutations in Epha7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Epha7 APN 4 28961285 intron probably benign
IGL00849:Epha7 APN 4 28870662 missense possibly damaging 0.63
IGL00898:Epha7 APN 4 28938693 missense probably damaging 1.00
IGL02036:Epha7 APN 4 28950509 missense probably damaging 1.00
IGL02227:Epha7 APN 4 28821587 missense possibly damaging 0.85
IGL02237:Epha7 APN 4 28949325 splice site probably null
IGL02376:Epha7 APN 4 28951287 missense probably damaging 1.00
IGL02424:Epha7 APN 4 28948790 intron probably benign
IGL02519:Epha7 APN 4 28821494 missense possibly damaging 0.91
IGL02522:Epha7 APN 4 28821494 missense possibly damaging 0.91
IGL02524:Epha7 APN 4 28821494 missense possibly damaging 0.91
IGL02602:Epha7 APN 4 28871877 missense possibly damaging 0.88
R0001:Epha7 UTSW 4 28961279 intron probably benign
R0011:Epha7 UTSW 4 28962564 missense probably benign 0.03
R0011:Epha7 UTSW 4 28962564 missense probably benign 0.03
R0310:Epha7 UTSW 4 28961301 missense probably benign 0.33
R0373:Epha7 UTSW 4 28935700 splice site probably null
R0496:Epha7 UTSW 4 28821292 missense probably damaging 1.00
R0554:Epha7 UTSW 4 28951401 missense probably damaging 1.00
R0632:Epha7 UTSW 4 28821104 missense probably damaging 1.00
R1677:Epha7 UTSW 4 28947571 nonsense probably null
R1883:Epha7 UTSW 4 28950362 missense possibly damaging 0.58
R1919:Epha7 UTSW 4 28963969 missense possibly damaging 0.48
R1952:Epha7 UTSW 4 28950474 missense probably damaging 0.97
R1999:Epha7 UTSW 4 28938686 nonsense probably null
R2187:Epha7 UTSW 4 28942648 missense possibly damaging 0.63
R2308:Epha7 UTSW 4 28821503 missense possibly damaging 0.91
R2417:Epha7 UTSW 4 28947579 missense probably damaging 1.00
R3911:Epha7 UTSW 4 28938680 missense probably benign 0.01
R4350:Epha7 UTSW 4 28950393 missense probably damaging 0.98
R4688:Epha7 UTSW 4 28821367 missense probably damaging 1.00
R4702:Epha7 UTSW 4 28961425 missense probably damaging 1.00
R4957:Epha7 UTSW 4 28871892 missense probably damaging 0.99
R5364:Epha7 UTSW 4 28950557 missense probably damaging 1.00
R5661:Epha7 UTSW 4 28946217 intron probably null
R5820:Epha7 UTSW 4 28949365 missense probably damaging 1.00
R6038:Epha7 UTSW 4 28821521 missense probably damaging 1.00
R6038:Epha7 UTSW 4 28821521 missense probably damaging 1.00
R6592:Epha7 UTSW 4 28813482 critical splice donor site probably null
R6783:Epha7 UTSW 4 28950528 missense possibly damaging 0.94
R6991:Epha7 UTSW 4 28821489 missense probably damaging 1.00
R7152:Epha7 UTSW 4 28935826 missense possibly damaging 0.94
R7232:Epha7 UTSW 4 28951279 missense probably damaging 1.00
R7261:Epha7 UTSW 4 28813418 missense probably benign 0.04
R7365:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7367:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7368:Epha7 UTSW 4 28871937 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCAATATGTCTTGCTCTTATCTGG -3'
(R):5'- GCTGAACACAGAAGTCAGTTTATG -3'

Sequencing Primer
(F):5'- GGATAAACCATTTTGCCTTCCAAGC -3'
(R):5'- CACAGAAGTCAGTTTATGATTGGG -3'
Posted On2019-06-07