Incidental Mutation 'PIT4514001:Zbtb8a'
ID556259
Institutional Source Beutler Lab
Gene Symbol Zbtb8a
Ensembl Gene ENSMUSG00000028807
Gene Namezinc finger and BTB domain containing 8a
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #PIT4514001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location129353628-129378116 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129357730 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 316 (D316G)
Ref Sequence ENSEMBL: ENSMUSP00000030610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030610] [ENSMUST00000146767]
Predicted Effect probably benign
Transcript: ENSMUST00000030610
AA Change: D316G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000030610
Gene: ENSMUSG00000028807
AA Change: D316G

DomainStartEndE-ValueType
BTB 24 122 2.49e-25 SMART
ZnF_C2H2 275 297 2.2e-2 SMART
ZnF_C2H2 303 326 4.17e-3 SMART
low complexity region 422 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146767
SMART Domains Protein: ENSMUSP00000114628
Gene: ENSMUSG00000057572

DomainStartEndE-ValueType
Pfam:Archease 31 145 3.5e-40 PFAM
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.2%
  • 20x: 70.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,801,871 H221Q probably benign Het
1700023F06Rik T C 11: 103,201,134 D27G probably benign Het
4930486L24Rik A G 13: 60,853,514 probably null Het
Abcc10 T A 17: 46,305,648 I1247F probably benign Het
Acap3 G A 4: 155,903,378 A524T probably benign Het
Adcy10 T A 1: 165,556,791 N1040K probably benign Het
Adrb2 T C 18: 62,179,727 D9G probably benign Het
Aldh1a7 T C 19: 20,702,240 T391A probably benign Het
Bcam A G 7: 19,764,066 V344A probably benign Het
Birc7 T A 2: 180,931,306 I172N possibly damaging Het
Cfap126 G A 1: 171,125,312 D45N probably damaging Het
Cit G A 5: 115,997,854 probably null Het
Col26a1 A G 5: 136,751,725 V295A probably benign Het
Epha7 C T 4: 28,961,355 Q867* probably null Het
Fn1 A G 1: 71,628,456 S793P probably benign Het
Foxb1 T A 9: 69,760,221 Y9F probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gpc1 T A 1: 92,857,557 M406K probably benign Het
Gsg1 T C 6: 135,237,576 T312A probably benign Het
Hmcn1 T A 1: 150,669,487 I2790F possibly damaging Het
Kcnma1 C T 14: 23,309,035 probably null Het
Lmntd1 AGACTGTAAGTTTCTCAAATGTGTACCTGGA AGA 6: 145,427,253 probably null Het
Mcph1 A G 8: 18,631,890 K348E probably damaging Het
Olfr122 T A 17: 37,771,867 N71K probably damaging Het
Olfr985 T C 9: 40,127,299 I221V probably damaging Het
Pik3cg T A 12: 32,204,903 R362W probably damaging Het
Pkp3 T C 7: 141,089,710 L765P probably damaging Het
Plxna2 A T 1: 194,794,937 I1252F probably benign Het
Prpf8 T C 11: 75,496,355 F1154S possibly damaging Het
Scn7a A G 2: 66,684,179 F1084L probably damaging Het
Shmt1 G A 11: 60,804,347 S47L probably damaging Het
Snap91 T C 9: 86,879,433 K40R possibly damaging Het
Spag17 A T 3: 100,013,211 T421S possibly damaging Het
Speer4f1 T A 5: 17,478,756 N139K possibly damaging Het
Syne2 T G 12: 76,105,015 N1883K probably damaging Het
Tgfb1i1 C T 7: 128,249,181 R191C probably damaging Het
Tmem39b A C 4: 129,684,497 N310K possibly damaging Het
Trim3 T C 7: 105,618,210 T321A probably benign Het
Vmn2r124 T C 17: 18,073,712 I687T probably benign Het
Zfp639 A G 3: 32,520,260 I345V possibly damaging Het
Zfp764 T C 7: 127,404,741 H406R probably benign Het
Other mutations in Zbtb8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Zbtb8a APN 4 129357847 missense probably damaging 1.00
R1033:Zbtb8a UTSW 4 129354221 missense possibly damaging 0.82
R1183:Zbtb8a UTSW 4 129357727 missense possibly damaging 0.94
R1755:Zbtb8a UTSW 4 129354317 missense possibly damaging 0.71
R2426:Zbtb8a UTSW 4 129360219 missense probably benign 0.00
R2520:Zbtb8a UTSW 4 129359896 critical splice donor site probably null
R5044:Zbtb8a UTSW 4 129360500 missense probably damaging 1.00
R6357:Zbtb8a UTSW 4 129354299 missense probably benign
R7129:Zbtb8a UTSW 4 129360395 missense probably damaging 1.00
T0722:Zbtb8a UTSW 4 129360019 small insertion probably benign
T0722:Zbtb8a UTSW 4 129360212 missense probably benign
T0975:Zbtb8a UTSW 4 129360019 small insertion probably benign
T0975:Zbtb8a UTSW 4 129360212 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTACTTCAGGGCCTCAAATGAG -3'
(R):5'- CAGTGATGTAATCCAACTGTCTCCT -3'

Sequencing Primer
(F):5'- AGACCTTGCTTAGCATGCAG -3'
(R):5'- GTCTCCTGACAGATGACCTGAC -3'
Posted On2019-06-07