Incidental Mutation 'PIT4514001:Speer4f1'
ID556263
Institutional Source Beutler Lab
Gene Symbol Speer4f1
Ensembl Gene ENSMUSG00000058643
Gene Namespermatogenesis associated glutamate (E)-rich protein 4F1
Synonyms4922502J04Rik, Speer4f, SPEER-4F
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #PIT4514001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location17476098-17480936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17478756 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 139 (N139K)
Ref Sequence ENSEMBL: ENSMUSP00000075467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076099]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076099
AA Change: N139K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075467
Gene: ENSMUSG00000058643
AA Change: N139K

DomainStartEndE-ValueType
Pfam:Takusan 50 128 1.2e-19 PFAM
low complexity region 224 258 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.2%
  • 20x: 70.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,801,871 H221Q probably benign Het
1700023F06Rik T C 11: 103,201,134 D27G probably benign Het
4930486L24Rik A G 13: 60,853,514 probably null Het
Abcc10 T A 17: 46,305,648 I1247F probably benign Het
Acap3 G A 4: 155,903,378 A524T probably benign Het
Adcy10 T A 1: 165,556,791 N1040K probably benign Het
Adrb2 T C 18: 62,179,727 D9G probably benign Het
Aldh1a7 T C 19: 20,702,240 T391A probably benign Het
Bcam A G 7: 19,764,066 V344A probably benign Het
Birc7 T A 2: 180,931,306 I172N possibly damaging Het
Cfap126 G A 1: 171,125,312 D45N probably damaging Het
Cit G A 5: 115,997,854 probably null Het
Col26a1 A G 5: 136,751,725 V295A probably benign Het
Epha7 C T 4: 28,961,355 Q867* probably null Het
Fn1 A G 1: 71,628,456 S793P probably benign Het
Foxb1 T A 9: 69,760,221 Y9F probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gpc1 T A 1: 92,857,557 M406K probably benign Het
Gsg1 T C 6: 135,237,576 T312A probably benign Het
Hmcn1 T A 1: 150,669,487 I2790F possibly damaging Het
Kcnma1 C T 14: 23,309,035 probably null Het
Lmntd1 AGACTGTAAGTTTCTCAAATGTGTACCTGGA AGA 6: 145,427,253 probably null Het
Mcph1 A G 8: 18,631,890 K348E probably damaging Het
Olfr122 T A 17: 37,771,867 N71K probably damaging Het
Olfr985 T C 9: 40,127,299 I221V probably damaging Het
Pik3cg T A 12: 32,204,903 R362W probably damaging Het
Pkp3 T C 7: 141,089,710 L765P probably damaging Het
Plxna2 A T 1: 194,794,937 I1252F probably benign Het
Prpf8 T C 11: 75,496,355 F1154S possibly damaging Het
Scn7a A G 2: 66,684,179 F1084L probably damaging Het
Shmt1 G A 11: 60,804,347 S47L probably damaging Het
Snap91 T C 9: 86,879,433 K40R possibly damaging Het
Spag17 A T 3: 100,013,211 T421S possibly damaging Het
Syne2 T G 12: 76,105,015 N1883K probably damaging Het
Tgfb1i1 C T 7: 128,249,181 R191C probably damaging Het
Tmem39b A C 4: 129,684,497 N310K possibly damaging Het
Trim3 T C 7: 105,618,210 T321A probably benign Het
Vmn2r124 T C 17: 18,073,712 I687T probably benign Het
Zbtb8a T C 4: 129,357,730 D316G probably benign Het
Zfp639 A G 3: 32,520,260 I345V possibly damaging Het
Zfp764 T C 7: 127,404,741 H406R probably benign Het
Other mutations in Speer4f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03344:Speer4f1 APN 5 17480334 missense possibly damaging 0.88
IGL02837:Speer4f1 UTSW 5 17480383 missense unknown
PIT4508001:Speer4f1 UTSW 5 17480414 missense unknown
R0165:Speer4f1 UTSW 5 17479514 nonsense probably null
R1557:Speer4f1 UTSW 5 17479492 missense probably damaging 1.00
R1740:Speer4f1 UTSW 5 17478761 missense probably damaging 1.00
R2332:Speer4f1 UTSW 5 17479524 missense probably damaging 0.99
R3890:Speer4f1 UTSW 5 17479502 missense probably damaging 0.98
R4659:Speer4f1 UTSW 5 17476223 missense possibly damaging 0.75
R4718:Speer4f1 UTSW 5 17480424 missense unknown
R5322:Speer4f1 UTSW 5 17477349 missense possibly damaging 0.47
R6075:Speer4f1 UTSW 5 17479484 missense possibly damaging 0.95
R6134:Speer4f1 UTSW 5 17476142 missense probably benign 0.10
R6192:Speer4f1 UTSW 5 17479495 missense probably damaging 1.00
R6277:Speer4f1 UTSW 5 17476243 missense probably damaging 0.99
R6803:Speer4f1 UTSW 5 17479390 splice site probably null
Z1088:Speer4f1 UTSW 5 17479479 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGTTCCTAAAAGCCTAAGTTCATGG -3'
(R):5'- TCTATTGGCTCCTGAGGATGC -3'

Sequencing Primer
(F):5'- AAGCCTAAGTTCATGGAGTTCTGTC -3'
(R):5'- TCCTGAGGATGCCTGGAGAAC -3'
Posted On2019-06-07