Incidental Mutation 'PIT4514001:Lmntd1'
ID556268
Institutional Source Beutler Lab
Gene Symbol Lmntd1
Ensembl Gene ENSMUSG00000054966
Gene Namelamin tail domain containing 1
SynonymsIfltd1, 4933403M22Rik, Lmna-rs1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #PIT4514001 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location145365134-145614319 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AGACTGTAAGTTTCTCAAATGTGTACCTGGA to AGA at 145427253 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111706] [ENSMUST00000111708] [ENSMUST00000148739] [ENSMUST00000149666]
Predicted Effect probably null
Transcript: ENSMUST00000111706
SMART Domains Protein: ENSMUSP00000107335
Gene: ENSMUSG00000054966

DomainStartEndE-ValueType
Pfam:LTD 121 240 1.1e-18 PFAM
low complexity region 324 340 N/A INTRINSIC
low complexity region 344 362 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111708
SMART Domains Protein: ENSMUSP00000107337
Gene: ENSMUSG00000054966

DomainStartEndE-ValueType
Pfam:LTD 174 287 1.6e-12 PFAM
low complexity region 374 390 N/A INTRINSIC
low complexity region 394 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148739
SMART Domains Protein: ENSMUSP00000120740
Gene: ENSMUSG00000054966

DomainStartEndE-ValueType
Pfam:LTD 24 144 1.2e-18 PFAM
low complexity region 228 244 N/A INTRINSIC
low complexity region 248 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149666
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.2%
  • 20x: 70.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,801,871 H221Q probably benign Het
1700023F06Rik T C 11: 103,201,134 D27G probably benign Het
4930486L24Rik A G 13: 60,853,514 probably null Het
Abcc10 T A 17: 46,305,648 I1247F probably benign Het
Acap3 G A 4: 155,903,378 A524T probably benign Het
Adcy10 T A 1: 165,556,791 N1040K probably benign Het
Adrb2 T C 18: 62,179,727 D9G probably benign Het
Aldh1a7 T C 19: 20,702,240 T391A probably benign Het
Bcam A G 7: 19,764,066 V344A probably benign Het
Birc7 T A 2: 180,931,306 I172N possibly damaging Het
Cfap126 G A 1: 171,125,312 D45N probably damaging Het
Cit G A 5: 115,997,854 probably null Het
Col26a1 A G 5: 136,751,725 V295A probably benign Het
Epha7 C T 4: 28,961,355 Q867* probably null Het
Fn1 A G 1: 71,628,456 S793P probably benign Het
Foxb1 T A 9: 69,760,221 Y9F probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gpc1 T A 1: 92,857,557 M406K probably benign Het
Gsg1 T C 6: 135,237,576 T312A probably benign Het
Hmcn1 T A 1: 150,669,487 I2790F possibly damaging Het
Kcnma1 C T 14: 23,309,035 probably null Het
Mcph1 A G 8: 18,631,890 K348E probably damaging Het
Olfr122 T A 17: 37,771,867 N71K probably damaging Het
Olfr985 T C 9: 40,127,299 I221V probably damaging Het
Pik3cg T A 12: 32,204,903 R362W probably damaging Het
Pkp3 T C 7: 141,089,710 L765P probably damaging Het
Plxna2 A T 1: 194,794,937 I1252F probably benign Het
Prpf8 T C 11: 75,496,355 F1154S possibly damaging Het
Scn7a A G 2: 66,684,179 F1084L probably damaging Het
Shmt1 G A 11: 60,804,347 S47L probably damaging Het
Snap91 T C 9: 86,879,433 K40R possibly damaging Het
Spag17 A T 3: 100,013,211 T421S possibly damaging Het
Speer4f1 T A 5: 17,478,756 N139K possibly damaging Het
Syne2 T G 12: 76,105,015 N1883K probably damaging Het
Tgfb1i1 C T 7: 128,249,181 R191C probably damaging Het
Tmem39b A C 4: 129,684,497 N310K possibly damaging Het
Trim3 T C 7: 105,618,210 T321A probably benign Het
Vmn2r124 T C 17: 18,073,712 I687T probably benign Het
Zbtb8a T C 4: 129,357,730 D316G probably benign Het
Zfp639 A G 3: 32,520,260 I345V possibly damaging Het
Zfp764 T C 7: 127,404,741 H406R probably benign Het
Other mutations in Lmntd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Lmntd1 APN 6 145433722 missense possibly damaging 0.92
IGL01986:Lmntd1 APN 6 145419807 missense probably damaging 1.00
IGL02064:Lmntd1 APN 6 145427276 splice site probably null
IGL02430:Lmntd1 APN 6 145413414 missense probably benign 0.34
IGL03296:Lmntd1 APN 6 145413477 missense probably benign 0.23
R0022:Lmntd1 UTSW 6 145429990 missense probably benign 0.06
R0050:Lmntd1 UTSW 6 145417476 missense probably damaging 1.00
R0084:Lmntd1 UTSW 6 145404528 missense unknown
R0631:Lmntd1 UTSW 6 145430000 missense probably benign 0.00
R1716:Lmntd1 UTSW 6 145419874 missense probably damaging 1.00
R1850:Lmntd1 UTSW 6 145413480 missense probably benign 0.06
R3898:Lmntd1 UTSW 6 145413426 missense probably benign 0.16
R4411:Lmntd1 UTSW 6 145427277 critical splice donor site probably null
R5596:Lmntd1 UTSW 6 145413414 missense probably benign 0.34
R5944:Lmntd1 UTSW 6 145427316 missense probably damaging 0.99
R6711:Lmntd1 UTSW 6 145543502 missense probably benign 0.04
R7369:Lmntd1 UTSW 6 145413575 missense probably damaging 1.00
R7445:Lmntd1 UTSW 6 145429967 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCATGTTTGCTCCTCTGGAAAC -3'
(R):5'- TAAAAGGCACCAGCTCCATGG -3'

Sequencing Primer
(F):5'- GCTCCTCTGGAAACTTCTATCAG -3'
(R):5'- AGTCGAGCTCTGACGTGGATAC -3'
Posted On2019-06-07