Incidental Mutation 'PIT4514001:Mcph1'
ID556274
Institutional Source Beutler Lab
Gene Symbol Mcph1
Ensembl Gene ENSMUSG00000039842
Gene Namemicrocephaly, primary autosomal recessive 1
SynonymsBRIT1, D030046N04Rik, 5430437K10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4514001 (G1)
Quality Score172.009
Status Not validated
Chromosome8
Chromosomal Location18595131-18803189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18631890 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 348 (K348E)
Ref Sequence ENSEMBL: ENSMUSP00000037000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039412] [ENSMUST00000124910] [ENSMUST00000133417] [ENSMUST00000141244] [ENSMUST00000146819]
Predicted Effect probably damaging
Transcript: ENSMUST00000039412
AA Change: K348E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037000
Gene: ENSMUSG00000039842
AA Change: K348E

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 597 1.2e-143 PFAM
BRCT 624 707 2.23e-2 SMART
BRCT 740 810 1.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124910
SMART Domains Protein: ENSMUSP00000131698
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133417
SMART Domains Protein: ENSMUSP00000121636
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
coiled coil region 14 41 N/A INTRINSIC
Pfam:Microcephalin 136 256 2.4e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141244
SMART Domains Protein: ENSMUSP00000119267
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
Blast:BRCT 2 38 2e-9 BLAST
low complexity region 39 51 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146819
AA Change: K348E

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131616
Gene: ENSMUSG00000039842
AA Change: K348E

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 598 1.4e-168 PFAM
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.2%
  • 20x: 70.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA damage response protein. The encoded protein may play a role in G2/M checkpoint arrest via maintenance of inhibitory phosphorylation of cyclin-dependent kinase 1. Mutations in this gene have been associated with primary autosomal recessive microcephaly 1 and premature chromosome condensation syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous null mice are born at a reduced rate and display male and female infertility and arrest of male meiosis. Mice homozygous for another knock-out allele exhibit microcephaly, infertility, decreased brain size, impaired neuroprogenitor proliferation and apoptosis, and mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,801,871 H221Q probably benign Het
1700023F06Rik T C 11: 103,201,134 D27G probably benign Het
4930486L24Rik A G 13: 60,853,514 probably null Het
Abcc10 T A 17: 46,305,648 I1247F probably benign Het
Acap3 G A 4: 155,903,378 A524T probably benign Het
Adcy10 T A 1: 165,556,791 N1040K probably benign Het
Adrb2 T C 18: 62,179,727 D9G probably benign Het
Aldh1a7 T C 19: 20,702,240 T391A probably benign Het
Bcam A G 7: 19,764,066 V344A probably benign Het
Birc7 T A 2: 180,931,306 I172N possibly damaging Het
Cfap126 G A 1: 171,125,312 D45N probably damaging Het
Cit G A 5: 115,997,854 probably null Het
Col26a1 A G 5: 136,751,725 V295A probably benign Het
Epha7 C T 4: 28,961,355 Q867* probably null Het
Fn1 A G 1: 71,628,456 S793P probably benign Het
Foxb1 T A 9: 69,760,221 Y9F probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gpc1 T A 1: 92,857,557 M406K probably benign Het
Gsg1 T C 6: 135,237,576 T312A probably benign Het
Hmcn1 T A 1: 150,669,487 I2790F possibly damaging Het
Kcnma1 C T 14: 23,309,035 probably null Het
Lmntd1 AGACTGTAAGTTTCTCAAATGTGTACCTGGA AGA 6: 145,427,253 probably null Het
Olfr122 T A 17: 37,771,867 N71K probably damaging Het
Olfr985 T C 9: 40,127,299 I221V probably damaging Het
Pik3cg T A 12: 32,204,903 R362W probably damaging Het
Pkp3 T C 7: 141,089,710 L765P probably damaging Het
Plxna2 A T 1: 194,794,937 I1252F probably benign Het
Prpf8 T C 11: 75,496,355 F1154S possibly damaging Het
Scn7a A G 2: 66,684,179 F1084L probably damaging Het
Shmt1 G A 11: 60,804,347 S47L probably damaging Het
Snap91 T C 9: 86,879,433 K40R possibly damaging Het
Spag17 A T 3: 100,013,211 T421S possibly damaging Het
Speer4f1 T A 5: 17,478,756 N139K possibly damaging Het
Syne2 T G 12: 76,105,015 N1883K probably damaging Het
Tgfb1i1 C T 7: 128,249,181 R191C probably damaging Het
Tmem39b A C 4: 129,684,497 N310K possibly damaging Het
Trim3 T C 7: 105,618,210 T321A probably benign Het
Vmn2r124 T C 17: 18,073,712 I687T probably benign Het
Zbtb8a T C 4: 129,357,730 D316G probably benign Het
Zfp639 A G 3: 32,520,260 I345V possibly damaging Het
Zfp764 T C 7: 127,404,741 H406R probably benign Het
Other mutations in Mcph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Mcph1 APN 8 18632620 missense possibly damaging 0.95
IGL00816:Mcph1 APN 8 18632397 missense possibly damaging 0.59
IGL01432:Mcph1 APN 8 18625639 missense probably damaging 0.99
IGL01674:Mcph1 APN 8 18631519 missense probably damaging 1.00
IGL01746:Mcph1 APN 8 18671127 missense probably damaging 1.00
IGL01788:Mcph1 APN 8 18632403 missense probably damaging 1.00
IGL01788:Mcph1 APN 8 18632404 missense probably damaging 1.00
IGL02185:Mcph1 APN 8 18668990 splice site probably benign
IGL02677:Mcph1 APN 8 18625593 missense probably damaging 1.00
IGL03376:Mcph1 APN 8 18596973 missense probably damaging 0.99
R0116:Mcph1 UTSW 8 18788248 missense probably benign 0.06
R0189:Mcph1 UTSW 8 18788471 missense probably damaging 0.96
R1510:Mcph1 UTSW 8 18632687 intron probably null
R1547:Mcph1 UTSW 8 18622686 missense possibly damaging 0.65
R1574:Mcph1 UTSW 8 18801412 missense probably damaging 0.99
R1574:Mcph1 UTSW 8 18801412 missense probably damaging 0.99
R1733:Mcph1 UTSW 8 18631963 missense probably benign 0.18
R1742:Mcph1 UTSW 8 18607363 missense probably benign 0.03
R1975:Mcph1 UTSW 8 18689065 splice site probably benign
R3836:Mcph1 UTSW 8 18622659 missense possibly damaging 0.91
R4405:Mcph1 UTSW 8 18632541 missense probably benign 0.00
R4493:Mcph1 UTSW 8 18631736 nonsense probably null
R4824:Mcph1 UTSW 8 18632687 intron probably null
R4873:Mcph1 UTSW 8 18625558 critical splice acceptor site probably null
R4875:Mcph1 UTSW 8 18625558 critical splice acceptor site probably null
R5125:Mcph1 UTSW 8 18607326 missense probably damaging 0.98
R5178:Mcph1 UTSW 8 18607326 missense probably damaging 0.98
R5217:Mcph1 UTSW 8 18788473 missense probably damaging 0.99
R5233:Mcph1 UTSW 8 18671238 missense probably damaging 0.96
R5299:Mcph1 UTSW 8 18652580 intron probably benign
R5335:Mcph1 UTSW 8 18689061 critical splice donor site probably null
R5579:Mcph1 UTSW 8 18632293 missense probably benign 0.18
R5621:Mcph1 UTSW 8 18632170 missense probably damaging 1.00
R5655:Mcph1 UTSW 8 18788310 missense probably benign 0.02
R5721:Mcph1 UTSW 8 18671207 missense probably damaging 0.99
R6076:Mcph1 UTSW 8 18631999 missense probably benign 0.40
R6592:Mcph1 UTSW 8 18668967 missense probably damaging 0.97
R7269:Mcph1 UTSW 8 18607272 splice site probably null
R7446:Mcph1 UTSW 8 18671093 missense probably benign 0.00
R7455:Mcph1 UTSW 8 18631759 missense probably benign 0.26
R7542:Mcph1 UTSW 8 18631689 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTCCAGACAGTCCTTCAAAG -3'
(R):5'- CAGGAGGAAGTCTCTCCGAATTC -3'

Sequencing Primer
(F):5'- TTCAAAGGAGAGCATCAACTGTC -3'
(R):5'- GAATTCCTCTCCTTGAGATTATCAGG -3'
Posted On2019-06-07