Incidental Mutation 'PIT4514001:Prpf8'
ID556279
Institutional Source Beutler Lab
Gene Symbol Prpf8
Ensembl Gene ENSMUSG00000020850
Gene Namepre-mRNA processing factor 8
SynonymsSfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #PIT4514001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location75486816-75509449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75496355 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1154 (F1154S)
Ref Sequence ENSEMBL: ENSMUSP00000018449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510] [ENSMUST00000131283]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018449
AA Change: F1154S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: F1154S

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-84 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 393 801 3.6e-226 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1079 7.1e-49 PFAM
Pfam:U5_2-snRNA_bdg 1208 1343 1.9e-73 PFAM
Pfam:U6-snRNA_bdg 1442 1601 3.7e-97 PFAM
Pfam:PRP8_domainIV 1760 1990 1.5e-132 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102510
AA Change: F1154S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: F1154S

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-90 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 395 801 2.9e-239 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1077 1.5e-51 PFAM
Pfam:U5_2-snRNA_bdg 1210 1343 1.1e-77 PFAM
Pfam:U6-snRNA_bdg 1442 1600 4.2e-97 PFAM
Pfam:PRP8_domainIV 1760 1989 9.8e-134 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131283
SMART Domains Protein: ENSMUSP00000115635
Gene: ENSMUSG00000020850

DomainStartEndE-ValueType
Pfam:PRO8NT 58 92 1.9e-13 PFAM
Pfam:PRO8NT 90 154 2.5e-30 PFAM
low complexity region 314 333 N/A INTRINSIC
Pfam:PROCN 338 746 1.7e-226 PFAM
low complexity region 747 759 N/A INTRINSIC
Pfam:RRM_4 931 1024 5.3e-49 PFAM
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.2%
  • 20x: 70.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,801,871 H221Q probably benign Het
1700023F06Rik T C 11: 103,201,134 D27G probably benign Het
4930486L24Rik A G 13: 60,853,514 probably null Het
Abcc10 T A 17: 46,305,648 I1247F probably benign Het
Acap3 G A 4: 155,903,378 A524T probably benign Het
Adcy10 T A 1: 165,556,791 N1040K probably benign Het
Adrb2 T C 18: 62,179,727 D9G probably benign Het
Aldh1a7 T C 19: 20,702,240 T391A probably benign Het
Bcam A G 7: 19,764,066 V344A probably benign Het
Birc7 T A 2: 180,931,306 I172N possibly damaging Het
Cfap126 G A 1: 171,125,312 D45N probably damaging Het
Cit G A 5: 115,997,854 probably null Het
Col26a1 A G 5: 136,751,725 V295A probably benign Het
Epha7 C T 4: 28,961,355 Q867* probably null Het
Fn1 A G 1: 71,628,456 S793P probably benign Het
Foxb1 T A 9: 69,760,221 Y9F probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gpc1 T A 1: 92,857,557 M406K probably benign Het
Gsg1 T C 6: 135,237,576 T312A probably benign Het
Hmcn1 T A 1: 150,669,487 I2790F possibly damaging Het
Kcnma1 C T 14: 23,309,035 probably null Het
Lmntd1 AGACTGTAAGTTTCTCAAATGTGTACCTGGA AGA 6: 145,427,253 probably null Het
Mcph1 A G 8: 18,631,890 K348E probably damaging Het
Olfr122 T A 17: 37,771,867 N71K probably damaging Het
Olfr985 T C 9: 40,127,299 I221V probably damaging Het
Pik3cg T A 12: 32,204,903 R362W probably damaging Het
Pkp3 T C 7: 141,089,710 L765P probably damaging Het
Plxna2 A T 1: 194,794,937 I1252F probably benign Het
Scn7a A G 2: 66,684,179 F1084L probably damaging Het
Shmt1 G A 11: 60,804,347 S47L probably damaging Het
Snap91 T C 9: 86,879,433 K40R possibly damaging Het
Spag17 A T 3: 100,013,211 T421S possibly damaging Het
Speer4f1 T A 5: 17,478,756 N139K possibly damaging Het
Syne2 T G 12: 76,105,015 N1883K probably damaging Het
Tgfb1i1 C T 7: 128,249,181 R191C probably damaging Het
Tmem39b A C 4: 129,684,497 N310K possibly damaging Het
Trim3 T C 7: 105,618,210 T321A probably benign Het
Vmn2r124 T C 17: 18,073,712 I687T probably benign Het
Zbtb8a T C 4: 129,357,730 D316G probably benign Het
Zfp639 A G 3: 32,520,260 I345V possibly damaging Het
Zfp764 T C 7: 127,404,741 H406R probably benign Het
Other mutations in Prpf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01376:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01393:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01395:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01554:Prpf8 APN 11 75495646 missense probably damaging 1.00
IGL01560:Prpf8 APN 11 75490406 missense possibly damaging 0.55
IGL01886:Prpf8 APN 11 75495744 missense probably benign 0.32
IGL01946:Prpf8 APN 11 75499992 missense probably damaging 1.00
IGL02022:Prpf8 APN 11 75501834 nonsense probably null
IGL02077:Prpf8 APN 11 75495809 missense probably damaging 0.96
IGL02141:Prpf8 APN 11 75490672 missense possibly damaging 0.68
IGL02455:Prpf8 APN 11 75509258 missense probably benign 0.32
cutter UTSW 11 75495426 splice site probably null
R0254:Prpf8 UTSW 11 75506362 missense possibly damaging 0.93
R0270:Prpf8 UTSW 11 75505249 missense probably damaging 0.99
R0504:Prpf8 UTSW 11 75501942 splice site probably benign
R0573:Prpf8 UTSW 11 75490654 missense probably damaging 1.00
R0613:Prpf8 UTSW 11 75503444 missense probably damaging 1.00
R0893:Prpf8 UTSW 11 75493949 missense probably damaging 1.00
R0967:Prpf8 UTSW 11 75494430 missense probably damaging 1.00
R0975:Prpf8 UTSW 11 75508674 unclassified probably benign
R1123:Prpf8 UTSW 11 75495285 missense probably damaging 1.00
R1183:Prpf8 UTSW 11 75490330 missense possibly damaging 0.95
R1857:Prpf8 UTSW 11 75495423 critical splice donor site probably null
R1901:Prpf8 UTSW 11 75504744 missense probably damaging 0.99
R1950:Prpf8 UTSW 11 75496511 missense possibly damaging 0.72
R2116:Prpf8 UTSW 11 75487721 missense possibly damaging 0.51
R2147:Prpf8 UTSW 11 75490531 missense probably benign
R2185:Prpf8 UTSW 11 75487113 nonsense probably null
R2271:Prpf8 UTSW 11 75495363 missense probably damaging 1.00
R2272:Prpf8 UTSW 11 75495363 missense probably damaging 1.00
R2898:Prpf8 UTSW 11 75496034 missense probably benign 0.00
R3744:Prpf8 UTSW 11 75506721 unclassified probably null
R3893:Prpf8 UTSW 11 75500257 missense possibly damaging 0.73
R4400:Prpf8 UTSW 11 75490702 missense possibly damaging 0.63
R4510:Prpf8 UTSW 11 75491826 missense probably damaging 0.96
R4511:Prpf8 UTSW 11 75491826 missense probably damaging 0.96
R4784:Prpf8 UTSW 11 75492505 missense probably damaging 1.00
R5089:Prpf8 UTSW 11 75509228 unclassified probably null
R5186:Prpf8 UTSW 11 75489783 missense possibly damaging 0.93
R5215:Prpf8 UTSW 11 75500204 missense probably benign 0.02
R5288:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5362:Prpf8 UTSW 11 75506410 missense possibly damaging 0.53
R5384:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5386:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5423:Prpf8 UTSW 11 75508958 missense probably damaging 1.00
R5472:Prpf8 UTSW 11 75503643 missense possibly damaging 0.89
R5539:Prpf8 UTSW 11 75503638 missense probably benign 0.20
R5620:Prpf8 UTSW 11 75505101 missense possibly damaging 0.95
R5669:Prpf8 UTSW 11 75504738 missense probably damaging 1.00
R5887:Prpf8 UTSW 11 75500908 missense possibly damaging 0.87
R5948:Prpf8 UTSW 11 75509189 missense possibly damaging 0.95
R6073:Prpf8 UTSW 11 75494022 critical splice donor site probably null
R6250:Prpf8 UTSW 11 75493508 missense possibly damaging 0.95
R6358:Prpf8 UTSW 11 75491495 missense probably benign 0.33
R6629:Prpf8 UTSW 11 75495426 splice site probably null
R6804:Prpf8 UTSW 11 75499809 missense possibly damaging 0.71
R6922:Prpf8 UTSW 11 75490736 missense probably damaging 1.00
R7035:Prpf8 UTSW 11 75504828 missense possibly damaging 0.72
R7038:Prpf8 UTSW 11 75496158 missense probably benign 0.02
R7089:Prpf8 UTSW 11 75508548 missense probably damaging 0.99
R7101:Prpf8 UTSW 11 75490400 missense possibly damaging 0.85
R7114:Prpf8 UTSW 11 75503355 nonsense probably null
R7182:Prpf8 UTSW 11 75490727 missense possibly damaging 0.96
R7290:Prpf8 UTSW 11 75493957 missense possibly damaging 0.85
R7323:Prpf8 UTSW 11 75491784 missense probably benign 0.32
X0028:Prpf8 UTSW 11 75506764 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCTGGGTTTGTGGAATCAC -3'
(R):5'- GGGGTCGTAAAAGGATGTCC -3'

Sequencing Primer
(F):5'- TGGAATCACGAGGATGTTAGTCC -3'
(R):5'- CTGGACTGTACCTCATTCTGTAGG -3'
Posted On2019-06-07