Incidental Mutation 'PIT4515001:Tsc2'
ID556349
Institutional Source Beutler Lab
Gene Symbol Tsc2
Ensembl Gene ENSMUSG00000002496
Gene Nametuberous sclerosis 2
Synonymstuberin, Nafld
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4515001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24595816-24632630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24621147 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 425 (N425S)
Ref Sequence ENSEMBL: ENSMUSP00000094986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097373] [ENSMUST00000226284] [ENSMUST00000226398] [ENSMUST00000227607] [ENSMUST00000227745] [ENSMUST00000228412]
Predicted Effect probably benign
Transcript: ENSMUST00000097373
AA Change: N425S

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000094986
Gene: ENSMUSG00000002496
AA Change: N425S

DomainStartEndE-ValueType
Pfam:DUF3384 54 470 4e-103 PFAM
Pfam:Tuberin 555 903 5.9e-149 PFAM
low complexity region 1023 1054 N/A INTRINSIC
low complexity region 1271 1278 N/A INTRINSIC
low complexity region 1310 1328 N/A INTRINSIC
low complexity region 1330 1344 N/A INTRINSIC
low complexity region 1378 1398 N/A INTRINSIC
Pfam:Rap_GAP 1497 1685 1.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226284
AA Change: N425S

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000226398
AA Change: N425S

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000227607
AA Change: N366S

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000227745
AA Change: N425S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000228412
AA Change: N425S

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 86.0%
  • 20x: 75.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene lead to tuberous sclerosis complex. Its gene product is believed to be a tumor suppressor and is able to stimulate specific GTPases. The protein associates with hamartin in a cytosolic complex, possibly acting as a chaperone for hamartin. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit liver hypoplasia, open neural tube, thickened myocardium and die by embryonic day 9.5-12.5. Heterozygotes develop renal cystadenomas, liver hemangiomas (sometimes resulting in fatal bleeding) and lung adenomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,111 R966* probably null Het
4932438A13Rik T A 3: 36,974,236 Y2351N probably damaging Het
Adam32 A T 8: 24,914,326 I221K possibly damaging Het
Adcy6 T C 15: 98,595,146 T880A probably benign Het
Agpat5 T A 8: 18,846,641 Y28N probably damaging Het
Atg2a A G 19: 6,253,585 I1125V probably damaging Het
B4galt6 A G 18: 20,688,467 Y335H probably benign Het
Bend3 A T 10: 43,510,634 E341V probably damaging Het
Ccdc136 T A 6: 29,417,226 V682E probably benign Het
Ccdc142 T C 6: 83,103,257 C394R probably benign Het
Cfap58 A G 19: 48,034,683 N845D probably benign Het
Col4a3 G A 1: 82,682,303 G890R unknown Het
Cyp1a2 C A 9: 57,681,959 V191L probably benign Het
Cyp51 A T 5: 4,099,122 probably null Het
Diras2 T C 13: 52,507,747 S175G possibly damaging Het
Dnah6 A G 6: 73,114,582 F2242S probably damaging Het
Erg T A 16: 95,409,760 N78Y probably benign Het
Fdft1 T A 14: 63,164,583 Q49L probably benign Het
Frem1 G T 4: 82,900,426 H2183Q probably damaging Het
Fut2 G A 7: 45,650,466 T294I probably damaging Het
Gabrb1 A C 5: 71,700,817 D62A probably damaging Het
Gbe1 T A 16: 70,441,116 Y263* probably null Het
Gimap6 T C 6: 48,702,568 D178G probably benign Het
Gm3106 T C 5: 94,220,972 M442T probably benign Het
Gm7682 A C 5: 94,446,835 K185Q probably benign Het
Gss T A 2: 155,578,341 T147S probably damaging Het
Hlcs A T 16: 94,267,416 V315E probably benign Het
Hoxa3 C T 6: 52,170,184 G363E unknown Het
Ift140 A G 17: 25,086,860 N807S probably damaging Het
Iglc1 T G 16: 19,061,951 D40A Het
Itga10 T A 3: 96,662,632 I1120N probably damaging Het
Jak3 T C 8: 71,679,642 V217A probably benign Het
Kank2 T G 9: 21,794,883 I280L probably benign Het
Kcnk1 G T 8: 126,025,342 G229V probably damaging Het
Kpna7 T C 5: 145,005,052 T143A probably benign Het
Letmd1 C T 15: 100,476,802 R310C probably damaging Het
Mga G A 2: 119,916,504 V379I probably damaging Het
Mto1 T A 9: 78,457,417 Y313N probably damaging Het
Muc5ac G A 7: 141,807,416 C1488Y probably damaging Het
Nde1 T A 16: 14,170,493 probably null Het
Nfatc3 T C 8: 106,079,203 S235P possibly damaging Het
Nup88 T C 11: 70,944,721 D602G probably benign Het
Olfr741 T A 14: 50,486,079 M207K probably benign Het
Olfr93 A C 17: 37,151,379 S198A probably benign Het
Pcnx G A 12: 81,991,787 C1309Y Het
Phldb1 A G 9: 44,715,960 I396T probably benign Het
Prss53 G A 7: 127,888,791 T173I probably benign Het
Ptpn11 C A 5: 121,164,554 D156Y probably damaging Het
Rfx8 A G 1: 39,690,105 Y167H probably benign Het
Rpsa T A 9: 120,131,148 I259N probably benign Het
Rrm2b G T 15: 37,946,804 D84E probably benign Het
Scgb2b19 A T 7: 33,279,611 probably null Het
Sik3 T C 9: 46,208,731 L706P probably damaging Het
Slc4a4 A T 5: 89,133,253 E426D probably damaging Het
Slc8a2 C A 7: 16,140,579 L251I possibly damaging Het
Taf6 T C 5: 138,182,242 K287E probably benign Het
Tiam1 G A 16: 89,860,242 T702I probably damaging Het
Tle1 A T 4: 72,199,319 F35I possibly damaging Het
Tle2 A G 10: 81,587,130 Q454R possibly damaging Het
Utp3 A G 5: 88,554,705 D31G probably benign Het
Vmn1r173 A T 7: 23,702,486 R49* probably null Het
Ybx2 T A 11: 69,940,398 V273E probably benign Het
Zbtb22 G A 17: 33,918,698 A606T probably benign Het
Zcchc8 A T 5: 123,700,932 D514E probably benign Het
Zfy2 T A Y: 2,117,096 I244F probably benign Het
Zglp1 T C 9: 21,066,189 N110S probably benign Het
Other mutations in Tsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Tsc2 APN 17 24608107 missense probably damaging 1.00
IGL00985:Tsc2 APN 17 24597131 missense probably damaging 1.00
IGL01386:Tsc2 APN 17 24613285 missense probably damaging 1.00
IGL01468:Tsc2 APN 17 24621097 missense possibly damaging 0.90
IGL01530:Tsc2 APN 17 24622662 missense possibly damaging 0.76
IGL02390:Tsc2 APN 17 24600453 missense probably damaging 1.00
IGL02398:Tsc2 APN 17 24621729 missense probably damaging 1.00
IGL02741:Tsc2 APN 17 24629969 missense probably damaging 1.00
IGL03191:Tsc2 APN 17 24628054 missense probably damaging 1.00
IGL03372:Tsc2 APN 17 24619470 missense probably damaging 1.00
IGL03412:Tsc2 APN 17 24597068 missense probably damaging 0.98
Twitch UTSW 17 24596742 unclassified probably null
R0025:Tsc2 UTSW 17 24631004 splice site probably benign
R0025:Tsc2 UTSW 17 24631004 splice site probably benign
R0138:Tsc2 UTSW 17 24599626 missense possibly damaging 0.65
R0540:Tsc2 UTSW 17 24621712 missense probably damaging 1.00
R0570:Tsc2 UTSW 17 24626727 missense probably damaging 1.00
R0607:Tsc2 UTSW 17 24621712 missense probably damaging 1.00
R0826:Tsc2 UTSW 17 24596958 missense probably benign 0.04
R1430:Tsc2 UTSW 17 24599023 critical splice donor site probably null
R1440:Tsc2 UTSW 17 24614392 missense probably damaging 1.00
R1466:Tsc2 UTSW 17 24608973 missense probably damaging 1.00
R1466:Tsc2 UTSW 17 24608973 missense probably damaging 1.00
R1541:Tsc2 UTSW 17 24631976 missense probably damaging 1.00
R1717:Tsc2 UTSW 17 24597068 missense probably damaging 0.98
R1799:Tsc2 UTSW 17 24604408 missense probably benign
R2030:Tsc2 UTSW 17 24623470 splice site probably benign
R2147:Tsc2 UTSW 17 24621142 missense possibly damaging 0.62
R2888:Tsc2 UTSW 17 24631995 critical splice donor site probably null
R3609:Tsc2 UTSW 17 24622550 missense possibly damaging 0.74
R3610:Tsc2 UTSW 17 24622550 missense possibly damaging 0.74
R3811:Tsc2 UTSW 17 24629037 missense probably benign 0.09
R3895:Tsc2 UTSW 17 24599812 missense probably damaging 1.00
R3962:Tsc2 UTSW 17 24621166 splice site probably benign
R3971:Tsc2 UTSW 17 24623588 missense probably damaging 1.00
R4018:Tsc2 UTSW 17 24625281 missense probably damaging 0.99
R4184:Tsc2 UTSW 17 24632016 missense probably benign 0.43
R4435:Tsc2 UTSW 17 24599713 missense probably benign 0.01
R4437:Tsc2 UTSW 17 24599713 missense probably benign 0.01
R4474:Tsc2 UTSW 17 24597264 missense probably damaging 0.98
R4703:Tsc2 UTSW 17 24604909 missense probably benign 0.13
R4731:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4732:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4733:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4817:Tsc2 UTSW 17 24596742 unclassified probably null
R4890:Tsc2 UTSW 17 24600035 missense probably damaging 1.00
R4922:Tsc2 UTSW 17 24600369 missense probably benign 0.22
R5119:Tsc2 UTSW 17 24603280 missense probably benign 0.00
R5393:Tsc2 UTSW 17 24600396 missense possibly damaging 0.89
R5785:Tsc2 UTSW 17 24599887 unclassified probably null
R5838:Tsc2 UTSW 17 24613216 missense probably benign 0.01
R5857:Tsc2 UTSW 17 24600007 missense probably damaging 0.99
R5911:Tsc2 UTSW 17 24600387 missense possibly damaging 0.63
R5988:Tsc2 UTSW 17 24620766 missense probably damaging 1.00
R6275:Tsc2 UTSW 17 24600420 missense probably benign 0.00
R6290:Tsc2 UTSW 17 24596910 missense probably benign 0.04
R6371:Tsc2 UTSW 17 24626714 missense probably benign 0.00
R6467:Tsc2 UTSW 17 24609127 missense probably benign 0.04
R6577:Tsc2 UTSW 17 24610499 missense probably damaging 1.00
R6728:Tsc2 UTSW 17 24621124 missense probably damaging 1.00
R6918:Tsc2 UTSW 17 24613229 missense probably damaging 1.00
R6995:Tsc2 UTSW 17 24628054 missense probably damaging 1.00
R7026:Tsc2 UTSW 17 24626739 missense probably damaging 0.99
R7136:Tsc2 UTSW 17 24613280 missense probably benign 0.00
R7236:Tsc2 UTSW 17 24623594 missense possibly damaging 0.82
R7243:Tsc2 UTSW 17 24599630 missense probably benign 0.02
R7249:Tsc2 UTSW 17 24607755 missense probably damaging 1.00
R7450:Tsc2 UTSW 17 24600031 missense probably damaging 1.00
R7522:Tsc2 UTSW 17 24630965 missense not run
R7529:Tsc2 UTSW 17 24597948 missense not run
Predicted Primers PCR Primer
(F):5'- CCGTGATTTTGGAGGCTCAG -3'
(R):5'- GCAGTCATTTTGCCAGGGTTAC -3'

Sequencing Primer
(F):5'- GCTCAGAAAGGAAAGCCTGATCTTAC -3'
(R):5'- CATAGCCTTGACAGGAGTCTC -3'
Posted On2019-06-07