Incidental Mutation 'PIT4576001:Dyrk3'
ID556358
Institutional Source Beutler Lab
Gene Symbol Dyrk3
Ensembl Gene ENSMUSG00000016526
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #PIT4576001 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location131127455-131138340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131130181 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 85 (V85A)
Ref Sequence ENSEMBL: ENSMUSP00000016670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016670] [ENSMUST00000189756]
Predicted Effect probably damaging
Transcript: ENSMUST00000016670
AA Change: V85A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000016670
Gene: ENSMUSG00000016526
AA Change: V85A

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
S_TKc 208 521 2.45e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189756
AA Change: V50A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140050
Gene: ENSMUSG00000016526
AA Change: V50A

DomainStartEndE-ValueType
PDB:4AZF|A 101 152 3e-18 PDB
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.3%
  • 20x: 72.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the DYRK family of dual-specificity protein kinases that catalyze autophosphorylation on serine/threonine and tyrosine residues. The members of this family share structural similarity, however, differ in their substrate specificity, suggesting their involvement in different cellular functions. The encoded protein has been shown to autophosphorylate on tyrosine residue and catalyze phosphorylation of histones H3 and H2B in vitro. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased erythropoiesis in response to chemically-induced anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,952,999 S73P probably damaging Het
5730596B20Rik G T 6: 52,179,469 V172F unknown Het
Brms1 A G 19: 5,046,201 K69E probably damaging Het
Calr4 A C 4: 109,235,856 Q44H possibly damaging Het
Dnmt1 G A 9: 20,911,775 T1242I probably benign Het
Eif2a T C 3: 58,545,553 Y250H probably damaging Het
Esco1 T C 18: 10,572,093 E749G probably damaging Het
Fat1 A G 8: 45,024,645 I2243V probably damaging Het
Gh A T 11: 106,300,833 F128I possibly damaging Het
Gm17669 TAA TAAA 18: 67,562,749 probably null Het
Gm5415 T C 1: 32,546,472 E119G probably damaging Het
Gtpbp4 A G 13: 8,991,727 Y150H probably damaging Het
Hist1h2ak C A 13: 21,753,611 D73Y probably damaging Het
Itga8 A G 2: 12,230,092 S452P probably benign Het
Kcnma1 C T 14: 23,309,035 probably null Het
Macf1 T C 4: 123,473,321 E2549G probably benign Het
Mindy1 C T 3: 95,288,069 A41V probably benign Het
Mypn T A 10: 63,120,071 K1201M probably damaging Het
Ncor1 A G 11: 62,333,717 S906P probably damaging Het
Npy1r T C 8: 66,704,222 V98A probably benign Het
Pate2 A G 9: 35,670,593 Y61C probably damaging Het
Pfdn2 A G 1: 171,345,742 S11G unknown Het
Prdm1 T C 10: 44,458,508 M1V probably null Het
Prelp A G 1: 133,915,165 S81P possibly damaging Het
Prss12 T C 3: 123,487,115 V483A probably damaging Het
Prss43 G C 9: 110,827,887 V154L probably damaging Het
Ptpru G A 4: 131,802,544 R618* probably null Het
Rpa1 A G 11: 75,313,158 S288P probably damaging Het
Siglec1 A G 2: 131,078,161 F817L probably damaging Het
Skint6 T A 4: 113,053,367 S545C possibly damaging Het
Slit1 A T 19: 41,624,549 V844D possibly damaging Het
Suclg2 G T 6: 95,587,018 D195E possibly damaging Het
Tln1 G T 4: 43,539,998 A1537D probably damaging Het
Trpv2 A G 11: 62,581,201 D73G probably damaging Het
Ucp3 T C 7: 100,480,251 S98P probably benign Het
Usp19 T A 9: 108,492,732 probably null Het
Vmn2r112 T C 17: 22,614,931 F527L probably benign Het
Vmn2r93 T C 17: 18,313,211 V459A probably benign Het
Other mutations in Dyrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Dyrk3 APN 1 131136337 missense possibly damaging 0.71
IGL00910:Dyrk3 APN 1 131136336 missense possibly damaging 0.92
IGL02436:Dyrk3 APN 1 131128865 missense probably benign 0.00
IGL03057:Dyrk3 APN 1 131129078 missense probably benign 0.01
R0116:Dyrk3 UTSW 1 131129839 missense probably damaging 1.00
R0361:Dyrk3 UTSW 1 131130032 missense probably benign 0.00
R0457:Dyrk3 UTSW 1 131136357 missense possibly damaging 0.94
R0529:Dyrk3 UTSW 1 131130121 missense probably benign 0.00
R0724:Dyrk3 UTSW 1 131130140 missense probably benign 0.00
R1116:Dyrk3 UTSW 1 131129182 missense probably damaging 1.00
R2999:Dyrk3 UTSW 1 131129446 missense probably damaging 1.00
R3423:Dyrk3 UTSW 1 131129482 missense probably damaging 1.00
R4591:Dyrk3 UTSW 1 131130158 missense probably damaging 1.00
R5358:Dyrk3 UTSW 1 131129695 missense probably damaging 1.00
R5608:Dyrk3 UTSW 1 131128715 missense probably benign
R6767:Dyrk3 UTSW 1 131129590 missense probably damaging 0.99
R7072:Dyrk3 UTSW 1 131129728 missense probably damaging 1.00
Z1088:Dyrk3 UTSW 1 131129233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGATCTCCAGCTTCTCGTAGG -3'
(R):5'- GCATTCCTGTGTGCATTTCAG -3'

Sequencing Primer
(F):5'- CAGCTTCTCGTAGGCAGTGAG -3'
(R):5'- ACTGCCATTAAATCTGGGGC -3'
Posted On2019-06-07