Incidental Mutation 'PIT4544001:Nudt21'
ID556415
Institutional Source Beutler Lab
Gene Symbol Nudt21
Ensembl Gene ENSMUSG00000031754
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 21
Synonyms25kDa, Cpsf5, 5730530J16Rik, 3110048P04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4544001 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location94015496-94037031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94019597 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 158 (F158I)
Ref Sequence ENSEMBL: ENSMUSP00000148485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034204] [ENSMUST00000212622] [ENSMUST00000212911] [ENSMUST00000212981]
Predicted Effect probably benign
Transcript: ENSMUST00000034204
SMART Domains Protein: ENSMUSP00000034204
Gene: ENSMUSG00000031754

DomainStartEndE-ValueType
Pfam:NUDIX_2 35 222 9.9e-85 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000212622
AA Change: F158I
Predicted Effect probably benign
Transcript: ENSMUST00000212911
Predicted Effect probably benign
Transcript: ENSMUST00000212981
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one subunit of a cleavage factor required for 3' RNA cleavage and polyadenylation processing. The interaction of the protein with the RNA is one of the earliest steps in the assembly of the 3' end processing complex and facilitates the recruitment of other processing factors. This gene encodes the 25kD subunit of the protein complex, which is composed of four polypeptides. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,405,079 D248G probably damaging Het
Abcc12 A T 8: 86,505,246 M1358K possibly damaging Het
Adgrl2 C T 3: 148,890,521 E60K probably damaging Het
Aff3 C T 1: 38,210,362 A555T probably benign Het
Aspn A T 13: 49,553,982 K106* probably null Het
Atp8b3 A T 10: 80,530,586 L281Q probably benign Het
Ccdc54 A T 16: 50,589,980 C308S possibly damaging Het
Cpa1 T C 6: 30,641,858 V227A probably benign Het
Dld G A 12: 31,335,557 Q262* probably null Het
Eif4e3 A T 6: 99,632,353 W161R probably damaging Het
Epha5 T A 5: 84,331,612 T178S possibly damaging Het
Erbb2 A T 11: 98,421,039 T134S probably benign Het
Golga3 A T 5: 110,188,690 E358D possibly damaging Het
Gon7 A T 12: 102,754,150 D74E probably benign Het
Hmcn2 A G 2: 31,428,250 E3869G probably damaging Het
Ifit1bl1 C T 19: 34,594,015 M347I possibly damaging Het
Ipo5 T A 14: 120,928,537 D331E probably damaging Het
Mep1a C T 17: 43,482,287 C355Y probably damaging Het
Nkain1 A G 4: 130,532,098 S196P probably damaging Het
Padi3 T C 4: 140,791,483 T443A probably benign Het
Parpbp A G 10: 88,114,549 V323A possibly damaging Het
Phkb A G 8: 86,011,637 I520V probably benign Het
Plxna1 A G 6: 89,357,429 S73P probably benign Het
Rfk T C 19: 17,395,344 S77P probably damaging Het
Sdk1 A G 5: 141,956,232 N545S probably benign Het
Setd2 A G 9: 110,551,164 N1349S probably damaging Het
Slc22a27 T A 19: 7,909,738 Q262L probably damaging Het
Slc34a3 T C 2: 25,230,595 D440G probably benign Het
Slc4a4 T C 5: 89,038,543 L161P probably damaging Het
Stxbp5 A C 10: 9,817,304 probably null Het
Tekt1 C T 11: 72,354,834 R165H probably damaging Het
Tmpo T C 10: 91,162,114 N604D probably benign Het
Trpm1 A T 7: 64,199,250 probably benign Het
Ubqln3 A C 7: 104,141,343 H513Q probably damaging Het
Ubr4 A G 4: 139,402,560 N664D possibly damaging Het
Usp37 G A 1: 74,470,579 T477I possibly damaging Het
Zbtb11 T G 16: 55,998,193 L660* probably null Het
Other mutations in Nudt21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Nudt21 APN 8 94019701 nonsense probably null
R1172:Nudt21 UTSW 8 94031129 splice site probably benign
R1576:Nudt21 UTSW 8 94028833 critical splice donor site probably null
R6293:Nudt21 UTSW 8 94028878 missense probably damaging 1.00
R6474:Nudt21 UTSW 8 94019654 missense probably benign 0.02
R6961:Nudt21 UTSW 8 94028880 missense probably benign
R7312:Nudt21 UTSW 8 94019599 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGATCCTCGGCTCTAAGACTTTTC -3'
(R):5'- ATGTTTAACATGTCGGAAGGGG -3'

Sequencing Primer
(F):5'- CCAAAAGCTAATGAACACTG -3'
(R):5'- TTTAACATGTCGGAAGGGGAGAGATG -3'
Posted On2019-06-07