Incidental Mutation 'PIT4544001:Aspn'
ID556425
Institutional Source Beutler Lab
Gene Symbol Aspn
Ensembl Gene ENSMUSG00000021388
Gene Nameasporin
SynonymsPLAP-1, 4631401G09Rik, SLRR1C
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4544001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location49544443-49567565 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 49553982 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 106 (K106*)
Ref Sequence ENSEMBL: ENSMUSP00000021820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000021820] [ENSMUST00000177948]
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000021820
AA Change: K106*
SMART Domains Protein: ENSMUSP00000021820
Gene: ENSMUSG00000021388
AA Change: K106*

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
LRRNT 67 99 8.23e-6 SMART
LRR 98 117 3.36e2 SMART
LRR 118 141 2.49e-1 SMART
LRR 142 165 5.41e0 SMART
LRR 187 212 9.5e1 SMART
Blast:LRR 232 256 9e-6 BLAST
LRR 257 280 4.83e0 SMART
LRR 281 303 6.23e1 SMART
LRR 304 327 2.03e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177948
AA Change: K106*
SMART Domains Protein: ENSMUSP00000136728
Gene: ENSMUSG00000021388
AA Change: K106*

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
LRRNT 67 99 8.23e-6 SMART
LRR 98 117 3.36e2 SMART
LRR 118 141 2.49e-1 SMART
LRR 142 165 5.41e0 SMART
LRR 187 212 9.5e1 SMART
Blast:LRR 232 256 9e-6 BLAST
LRR 257 280 4.83e0 SMART
LRR 281 303 6.23e1 SMART
LRR 304 327 2.03e2 SMART
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the small leucine-rich proteoglycan family. The encoded protein is an extracellular matrix protein that modulates the transforming growth factor-beta signaling pathway, regulating cartilage matrix gene expression and cartilage formation. The protein plays a role in the pathology of osteoarthritis. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,405,079 D248G probably damaging Het
Abcc12 A T 8: 86,505,246 M1358K possibly damaging Het
Adgrl2 C T 3: 148,890,521 E60K probably damaging Het
Aff3 C T 1: 38,210,362 A555T probably benign Het
Atp8b3 A T 10: 80,530,586 L281Q probably benign Het
Ccdc54 A T 16: 50,589,980 C308S possibly damaging Het
Cpa1 T C 6: 30,641,858 V227A probably benign Het
Dld G A 12: 31,335,557 Q262* probably null Het
Eif4e3 A T 6: 99,632,353 W161R probably damaging Het
Epha5 T A 5: 84,331,612 T178S possibly damaging Het
Erbb2 A T 11: 98,421,039 T134S probably benign Het
Golga3 A T 5: 110,188,690 E358D possibly damaging Het
Gon7 A T 12: 102,754,150 D74E probably benign Het
Hmcn2 A G 2: 31,428,250 E3869G probably damaging Het
Ifit1bl1 C T 19: 34,594,015 M347I possibly damaging Het
Ipo5 T A 14: 120,928,537 D331E probably damaging Het
Mep1a C T 17: 43,482,287 C355Y probably damaging Het
Nkain1 A G 4: 130,532,098 S196P probably damaging Het
Nudt21 A T 8: 94,019,597 F158I unknown Het
Padi3 T C 4: 140,791,483 T443A probably benign Het
Parpbp A G 10: 88,114,549 V323A possibly damaging Het
Phkb A G 8: 86,011,637 I520V probably benign Het
Plxna1 A G 6: 89,357,429 S73P probably benign Het
Rfk T C 19: 17,395,344 S77P probably damaging Het
Sdk1 A G 5: 141,956,232 N545S probably benign Het
Setd2 A G 9: 110,551,164 N1349S probably damaging Het
Slc22a27 T A 19: 7,909,738 Q262L probably damaging Het
Slc34a3 T C 2: 25,230,595 D440G probably benign Het
Slc4a4 T C 5: 89,038,543 L161P probably damaging Het
Stxbp5 A C 10: 9,817,304 probably null Het
Tekt1 C T 11: 72,354,834 R165H probably damaging Het
Tmpo T C 10: 91,162,114 N604D probably benign Het
Trpm1 A T 7: 64,199,250 probably benign Het
Ubqln3 A C 7: 104,141,343 H513Q probably damaging Het
Ubr4 A G 4: 139,402,560 N664D possibly damaging Het
Usp37 G A 1: 74,470,579 T477I possibly damaging Het
Zbtb11 T G 16: 55,998,193 L660* probably null Het
Other mutations in Aspn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Aspn APN 13 49566492 missense probably benign 0.06
IGL00796:Aspn APN 13 49557417 missense probably damaging 0.98
IGL01088:Aspn APN 13 49566553 missense probably benign 0.00
IGL02633:Aspn APN 13 49551887 missense possibly damaging 0.93
IGL03180:Aspn APN 13 49563515 missense probably damaging 1.00
R0699:Aspn UTSW 13 49551782 missense possibly damaging 0.63
R1445:Aspn UTSW 13 49557373 missense possibly damaging 0.75
R1749:Aspn UTSW 13 49551785 missense probably benign 0.01
R2907:Aspn UTSW 13 49551898 missense probably damaging 1.00
R3744:Aspn UTSW 13 49566560 missense probably damaging 0.96
R3745:Aspn UTSW 13 49566560 missense probably damaging 0.96
R4625:Aspn UTSW 13 49557425 missense probably benign
R5061:Aspn UTSW 13 49566604 missense probably damaging 0.99
R5712:Aspn UTSW 13 49563519 missense probably damaging 1.00
R7079:Aspn UTSW 13 49566555 missense probably damaging 1.00
R7210:Aspn UTSW 13 49566491 missense probably benign 0.14
R7273:Aspn UTSW 13 49558876 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCCAGGTTCAAAACAGATAG -3'
(R):5'- TTGCAGTAGGACACCCATAGG -3'

Sequencing Primer
(F):5'- CAGGTTCAAAACAGATAGATACCTTG -3'
(R):5'- CCCATAGGAAACTAAGATGTCT -3'
Posted On2019-06-07