Incidental Mutation 'PIT4544001:Ccdc54'
ID556428
Institutional Source Beutler Lab
Gene Symbol Ccdc54
Ensembl Gene ENSMUSG00000050685
Gene Namecoiled-coil domain containing 54
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #PIT4544001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location50589857-50591154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50589980 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 308 (C308S)
Ref Sequence ENSEMBL: ENSMUSP00000049864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062439]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062439
AA Change: C308S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049864
Gene: ENSMUSG00000050685
AA Change: C308S

DomainStartEndE-ValueType
low complexity region 36 45 N/A INTRINSIC
coiled coil region 79 148 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,405,079 D248G probably damaging Het
Abcc12 A T 8: 86,505,246 M1358K possibly damaging Het
Adgrl2 C T 3: 148,890,521 E60K probably damaging Het
Aff3 C T 1: 38,210,362 A555T probably benign Het
Aspn A T 13: 49,553,982 K106* probably null Het
Atp8b3 A T 10: 80,530,586 L281Q probably benign Het
Cpa1 T C 6: 30,641,858 V227A probably benign Het
Dld G A 12: 31,335,557 Q262* probably null Het
Eif4e3 A T 6: 99,632,353 W161R probably damaging Het
Epha5 T A 5: 84,331,612 T178S possibly damaging Het
Erbb2 A T 11: 98,421,039 T134S probably benign Het
Golga3 A T 5: 110,188,690 E358D possibly damaging Het
Gon7 A T 12: 102,754,150 D74E probably benign Het
Hmcn2 A G 2: 31,428,250 E3869G probably damaging Het
Ifit1bl1 C T 19: 34,594,015 M347I possibly damaging Het
Ipo5 T A 14: 120,928,537 D331E probably damaging Het
Mep1a C T 17: 43,482,287 C355Y probably damaging Het
Nkain1 A G 4: 130,532,098 S196P probably damaging Het
Nudt21 A T 8: 94,019,597 F158I unknown Het
Padi3 T C 4: 140,791,483 T443A probably benign Het
Parpbp A G 10: 88,114,549 V323A possibly damaging Het
Phkb A G 8: 86,011,637 I520V probably benign Het
Plxna1 A G 6: 89,357,429 S73P probably benign Het
Rfk T C 19: 17,395,344 S77P probably damaging Het
Sdk1 A G 5: 141,956,232 N545S probably benign Het
Setd2 A G 9: 110,551,164 N1349S probably damaging Het
Slc22a27 T A 19: 7,909,738 Q262L probably damaging Het
Slc34a3 T C 2: 25,230,595 D440G probably benign Het
Slc4a4 T C 5: 89,038,543 L161P probably damaging Het
Stxbp5 A C 10: 9,817,304 probably null Het
Tekt1 C T 11: 72,354,834 R165H probably damaging Het
Tmpo T C 10: 91,162,114 N604D probably benign Het
Trpm1 A T 7: 64,199,250 probably benign Het
Ubqln3 A C 7: 104,141,343 H513Q probably damaging Het
Ubr4 A G 4: 139,402,560 N664D possibly damaging Het
Usp37 G A 1: 74,470,579 T477I possibly damaging Het
Zbtb11 T G 16: 55,998,193 L660* probably null Het
Other mutations in Ccdc54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Ccdc54 APN 16 50589917 missense possibly damaging 0.92
IGL01636:Ccdc54 APN 16 50589914 makesense probably null
IGL01918:Ccdc54 APN 16 50590852 nonsense probably null
IGL03205:Ccdc54 APN 16 50590891 missense possibly damaging 0.94
PIT4382001:Ccdc54 UTSW 16 50590856 missense probably damaging 0.97
R0053:Ccdc54 UTSW 16 50590234 missense probably benign 0.23
R0053:Ccdc54 UTSW 16 50590234 missense probably benign 0.23
R0312:Ccdc54 UTSW 16 50590802 missense possibly damaging 0.66
R1742:Ccdc54 UTSW 16 50590238 missense possibly damaging 0.66
R2054:Ccdc54 UTSW 16 50590624 missense probably damaging 0.97
R4594:Ccdc54 UTSW 16 50590017 nonsense probably null
R6549:Ccdc54 UTSW 16 50590025 missense possibly damaging 0.66
R7034:Ccdc54 UTSW 16 50590588 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAGCCAGCAAGCTAGAGTC -3'
(R):5'- CAAAATGCATCAGTGGGTTGC -3'

Sequencing Primer
(F):5'- GCAAGCTAGAGTCCACAGGC -3'
(R):5'- CTGACTTCAGTACATGGATCAAGCTC -3'
Posted On2019-06-07