Incidental Mutation 'PIT4531001:Sec24d'
ID556445
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene NameSec24 related gene family, member D (S. cerevisiae)
Synonyms2310020L09Rik, LOC383951
Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4531001 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location123267455-123365641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 123343178 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 520 (P520L)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
Predicted Effect probably damaging
Transcript: ENSMUST00000047923
AA Change: P520L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: P520L

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.6%
  • 10x: 84.3%
  • 20x: 70.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk T G 9: 59,310,317 D204E probably damaging Het
Aqr C A 2: 114,130,734 V682L possibly damaging Het
Bmper A T 9: 23,224,817 N65Y possibly damaging Het
Calb1 T C 4: 15,900,925 L171P probably damaging Het
Card11 T C 5: 140,906,660 M217V probably damaging Het
Col11a2 A G 17: 34,046,438 probably null Het
Dpm1 T C 2: 168,210,552 T255A probably benign Het
Efhb A G 17: 53,445,775 Y440H probably damaging Het
Elp2 T C 18: 24,604,113 V40A probably damaging Het
Fam103a1 C T 7: 81,767,579 P9L possibly damaging Het
Far2 A T 6: 148,175,131 N491Y possibly damaging Het
Frem1 T A 4: 82,950,280 H1488L probably benign Het
Frrs1l C A 4: 56,990,144 R43L unknown Het
Galnt3 G A 2: 66,107,088 R93C probably benign Het
Gm8225 A G 17: 26,543,389 T185A possibly damaging Het
H2-Q1 T C 17: 35,320,916 F54L probably benign Het
H2-Q1 A T 17: 35,321,079 Q108L probably damaging Het
Hoxc12 T G 15: 102,938,420 L249W probably damaging Het
Lrrc75b A T 10: 75,557,265 H83Q probably damaging Het
Muc4 A T 16: 32,756,017 T1964S unknown Het
Nob1 T C 8: 107,418,417 D142G probably benign Het
Olfr1155 A G 2: 87,943,227 Y134H probably damaging Het
Olfr1180 A T 2: 88,411,760 H299Q probably benign Het
Olfr1184 A T 2: 88,487,257 Y175F possibly damaging Het
Olfr1389 T C 11: 49,430,926 V150A probably benign Het
Olfr1449 G A 19: 12,935,277 D180N probably damaging Het
Patj A T 4: 98,441,090 N527I probably damaging Het
Pik3c2g A G 6: 139,859,370 I543V Het
Ppp1r2 A T 16: 31,258,461 N150K probably damaging Het
Prl7d1 A T 13: 27,710,178 L135Q probably damaging Het
Ralgds G T 2: 28,545,214 E461* probably null Het
Rasa3 T A 8: 13,605,887 H116L probably benign Het
Sfmbt1 T G 14: 30,796,326 S376A probably benign Het
Sspo A G 6: 48,481,239 T3290A probably benign Het
Stk25 G A 1: 93,624,624 P345S probably benign Het
Sycp2l A G 13: 41,146,672 E454G probably null Het
Tecpr1 T C 5: 144,214,067 K308E probably damaging Het
Thtpa C T 14: 55,095,505 P16S probably damaging Het
Trim65 T A 11: 116,127,709 I247F possibly damaging Het
Trpc6 T G 9: 8,610,148 Y206D probably benign Het
Ttn G A 2: 76,872,963 T9357I unknown Het
Ugt2b1 C A 5: 86,926,483 A6S probably benign Het
Vmn1r175 A G 7: 23,809,178 V8A possibly damaging Het
Vps13b T A 15: 35,878,825 I2990N probably damaging Het
Xirp2 G A 2: 67,515,482 R2689Q possibly damaging Het
Zfp831 T A 2: 174,646,723 Y1064N possibly damaging Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCCTGCCTCAAGTTAGG -3'
(R):5'- ATGCTCATACAAGGAACAGGC -3'

Sequencing Primer
(F):5'- CCTGCCTCAAGTTAGGTTTTG -3'
(R):5'- AAGGAACAGGCCCCTTTCCTTC -3'
Posted On2019-06-07