Incidental Mutation 'PIT4531001:Pik3c2g'
ID556454
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #PIT4531001 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location139587221-139969284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139859370 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 543 (I543V)
Ref Sequence ENSEMBL: ENSMUSP00000107499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]
Predicted Effect probably benign
Transcript: ENSMUST00000087657
AA Change: I175V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: I175V

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: I543V

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.6%
  • 10x: 84.3%
  • 20x: 70.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk T G 9: 59,310,317 D204E probably damaging Het
Aqr C A 2: 114,130,734 V682L possibly damaging Het
Bmper A T 9: 23,224,817 N65Y possibly damaging Het
Calb1 T C 4: 15,900,925 L171P probably damaging Het
Card11 T C 5: 140,906,660 M217V probably damaging Het
Col11a2 A G 17: 34,046,438 probably null Het
Dpm1 T C 2: 168,210,552 T255A probably benign Het
Efhb A G 17: 53,445,775 Y440H probably damaging Het
Elp2 T C 18: 24,604,113 V40A probably damaging Het
Fam103a1 C T 7: 81,767,579 P9L possibly damaging Het
Far2 A T 6: 148,175,131 N491Y possibly damaging Het
Frem1 T A 4: 82,950,280 H1488L probably benign Het
Frrs1l C A 4: 56,990,144 R43L unknown Het
Galnt3 G A 2: 66,107,088 R93C probably benign Het
Gm8225 A G 17: 26,543,389 T185A possibly damaging Het
H2-Q1 T C 17: 35,320,916 F54L probably benign Het
H2-Q1 A T 17: 35,321,079 Q108L probably damaging Het
Hoxc12 T G 15: 102,938,420 L249W probably damaging Het
Lrrc75b A T 10: 75,557,265 H83Q probably damaging Het
Muc4 A T 16: 32,756,017 T1964S unknown Het
Nob1 T C 8: 107,418,417 D142G probably benign Het
Olfr1155 A G 2: 87,943,227 Y134H probably damaging Het
Olfr1180 A T 2: 88,411,760 H299Q probably benign Het
Olfr1184 A T 2: 88,487,257 Y175F possibly damaging Het
Olfr1389 T C 11: 49,430,926 V150A probably benign Het
Olfr1449 G A 19: 12,935,277 D180N probably damaging Het
Patj A T 4: 98,441,090 N527I probably damaging Het
Ppp1r2 A T 16: 31,258,461 N150K probably damaging Het
Prl7d1 A T 13: 27,710,178 L135Q probably damaging Het
Ralgds G T 2: 28,545,214 E461* probably null Het
Rasa3 T A 8: 13,605,887 H116L probably benign Het
Sec24d C T 3: 123,343,178 P520L probably damaging Het
Sfmbt1 T G 14: 30,796,326 S376A probably benign Het
Sspo A G 6: 48,481,239 T3290A probably benign Het
Stk25 G A 1: 93,624,624 P345S probably benign Het
Sycp2l A G 13: 41,146,672 E454G probably null Het
Tecpr1 T C 5: 144,214,067 K308E probably damaging Het
Thtpa C T 14: 55,095,505 P16S probably damaging Het
Trim65 T A 11: 116,127,709 I247F possibly damaging Het
Trpc6 T G 9: 8,610,148 Y206D probably benign Het
Ttn G A 2: 76,872,963 T9357I unknown Het
Ugt2b1 C A 5: 86,926,483 A6S probably benign Het
Vmn1r175 A G 7: 23,809,178 V8A possibly damaging Het
Vps13b T A 15: 35,878,825 I2990N probably damaging Het
Xirp2 G A 2: 67,515,482 R2689Q possibly damaging Het
Zfp831 T A 2: 174,646,723 Y1064N possibly damaging Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 unclassified probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense probably damaging 1.00
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTAAGCTGCTTCTGATTGGTCTG -3'
(R):5'- AATATTCAACGGACCGGAGCAC -3'

Sequencing Primer
(F):5'- GCTTCTGATTGGTCTGATGAAAACC -3'
(R):5'- CGGACCGGAGCACATTCTTATTTAAC -3'
Posted On2019-06-07