Incidental Mutation 'PIT4531001:Vmn1r175'
ID556456
Institutional Source Beutler Lab
Gene Symbol Vmn1r175
Ensembl Gene ENSMUSG00000095632
Gene Namevomeronasal 1 receptor 175
SynonymsGm6299
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #PIT4531001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location23807182-23810643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23809178 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 8 (V8A)
Ref Sequence ENSEMBL: ENSMUSP00000126357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166141] [ENSMUST00000228383]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166141
AA Change: V8A

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126357
Gene: ENSMUSG00000095632
AA Change: V8A

DomainStartEndE-ValueType
Pfam:TAS2R 8 296 8.8e-15 PFAM
Pfam:7tm_1 13 285 2.5e-6 PFAM
Pfam:V1R 41 295 4.4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000228383
AA Change: V8A

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.6%
  • 10x: 84.3%
  • 20x: 70.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk T G 9: 59,310,317 D204E probably damaging Het
Aqr C A 2: 114,130,734 V682L possibly damaging Het
Bmper A T 9: 23,224,817 N65Y possibly damaging Het
Calb1 T C 4: 15,900,925 L171P probably damaging Het
Card11 T C 5: 140,906,660 M217V probably damaging Het
Col11a2 A G 17: 34,046,438 probably null Het
Dpm1 T C 2: 168,210,552 T255A probably benign Het
Efhb A G 17: 53,445,775 Y440H probably damaging Het
Elp2 T C 18: 24,604,113 V40A probably damaging Het
Fam103a1 C T 7: 81,767,579 P9L possibly damaging Het
Far2 A T 6: 148,175,131 N491Y possibly damaging Het
Frem1 T A 4: 82,950,280 H1488L probably benign Het
Frrs1l C A 4: 56,990,144 R43L unknown Het
Galnt3 G A 2: 66,107,088 R93C probably benign Het
Gm8225 A G 17: 26,543,389 T185A possibly damaging Het
H2-Q1 T C 17: 35,320,916 F54L probably benign Het
H2-Q1 A T 17: 35,321,079 Q108L probably damaging Het
Hoxc12 T G 15: 102,938,420 L249W probably damaging Het
Lrrc75b A T 10: 75,557,265 H83Q probably damaging Het
Muc4 A T 16: 32,756,017 T1964S unknown Het
Nob1 T C 8: 107,418,417 D142G probably benign Het
Olfr1155 A G 2: 87,943,227 Y134H probably damaging Het
Olfr1180 A T 2: 88,411,760 H299Q probably benign Het
Olfr1184 A T 2: 88,487,257 Y175F possibly damaging Het
Olfr1389 T C 11: 49,430,926 V150A probably benign Het
Olfr1449 G A 19: 12,935,277 D180N probably damaging Het
Patj A T 4: 98,441,090 N527I probably damaging Het
Pik3c2g A G 6: 139,859,370 I543V Het
Ppp1r2 A T 16: 31,258,461 N150K probably damaging Het
Prl7d1 A T 13: 27,710,178 L135Q probably damaging Het
Ralgds G T 2: 28,545,214 E461* probably null Het
Rasa3 T A 8: 13,605,887 H116L probably benign Het
Sec24d C T 3: 123,343,178 P520L probably damaging Het
Sfmbt1 T G 14: 30,796,326 S376A probably benign Het
Sspo A G 6: 48,481,239 T3290A probably benign Het
Stk25 G A 1: 93,624,624 P345S probably benign Het
Sycp2l A G 13: 41,146,672 E454G probably null Het
Tecpr1 T C 5: 144,214,067 K308E probably damaging Het
Thtpa C T 14: 55,095,505 P16S probably damaging Het
Trim65 T A 11: 116,127,709 I247F possibly damaging Het
Trpc6 T G 9: 8,610,148 Y206D probably benign Het
Ttn G A 2: 76,872,963 T9357I unknown Het
Ugt2b1 C A 5: 86,926,483 A6S probably benign Het
Vps13b T A 15: 35,878,825 I2990N probably damaging Het
Xirp2 G A 2: 67,515,482 R2689Q possibly damaging Het
Zfp831 T A 2: 174,646,723 Y1064N possibly damaging Het
Other mutations in Vmn1r175
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02944:Vmn1r175 APN 7 23809166 missense probably damaging 0.97
R1163:Vmn1r175 UTSW 7 23808512 missense probably benign 0.30
R1901:Vmn1r175 UTSW 7 23808793 missense probably benign 0.00
R1926:Vmn1r175 UTSW 7 23809041 missense possibly damaging 0.81
R1957:Vmn1r175 UTSW 7 23808383 missense probably benign 0.21
R2163:Vmn1r175 UTSW 7 23808927 missense probably benign 0.29
R2381:Vmn1r175 UTSW 7 23808668 missense probably benign 0.31
R3109:Vmn1r175 UTSW 7 23808968 missense probably benign 0.00
R3419:Vmn1r175 UTSW 7 23808650 missense probably damaging 0.96
R3941:Vmn1r175 UTSW 7 23808968 missense probably benign 0.00
R4982:Vmn1r175 UTSW 7 23809069 missense possibly damaging 0.61
R5191:Vmn1r175 UTSW 7 23809022 missense possibly damaging 0.91
R5326:Vmn1r175 UTSW 7 23809106 missense possibly damaging 0.88
R5333:Vmn1r175 UTSW 7 23808579 missense possibly damaging 0.69
R5476:Vmn1r175 UTSW 7 23809131 missense possibly damaging 0.82
R5542:Vmn1r175 UTSW 7 23809106 missense possibly damaging 0.88
R5761:Vmn1r175 UTSW 7 23808480 missense probably benign 0.01
R5918:Vmn1r175 UTSW 7 23808947 missense probably damaging 1.00
R6163:Vmn1r175 UTSW 7 23809166 missense possibly damaging 0.71
R6563:Vmn1r175 UTSW 7 23808605 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AATCAAGGTATTGCCCACAGC -3'
(R):5'- GAGATAATGCTGCATCACACAC -3'

Sequencing Primer
(F):5'- ATTGCCCACAGCTAAGTTGG -3'
(R):5'- TCATGCAGTGTTTCCAGTCAACATG -3'
Posted On2019-06-07