Incidental Mutation 'PIT4531001:Fam103a1'
ID556457
Institutional Source Beutler Lab
Gene Symbol Fam103a1
Ensembl Gene ENSMUSG00000038646
Gene Namefamily with sequence similarity 103, member A1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #PIT4531001 (G1)
Quality Score221.009
Status Not validated
Chromosome7
Chromosomal Location81762925-81769491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81767579 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 9 (P9L)
Ref Sequence ENSEMBL: ENSMUSP00000039065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042166] [ENSMUST00000118190] [ENSMUST00000133034]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042166
AA Change: P9L

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039065
Gene: ENSMUSG00000038646
AA Change: P9L

DomainStartEndE-ValueType
Pfam:RAM 10 87 4.9e-28 PFAM
low complexity region 89 112 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118190
AA Change: P9L

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113339
Gene: ENSMUSG00000038646
AA Change: P9L

DomainStartEndE-ValueType
Pfam:RAM 9 89 5.1e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133034
AA Change: P9L

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.6%
  • 10x: 84.3%
  • 20x: 70.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk T G 9: 59,310,317 D204E probably damaging Het
Aqr C A 2: 114,130,734 V682L possibly damaging Het
Bmper A T 9: 23,224,817 N65Y possibly damaging Het
Calb1 T C 4: 15,900,925 L171P probably damaging Het
Card11 T C 5: 140,906,660 M217V probably damaging Het
Col11a2 A G 17: 34,046,438 probably null Het
Dpm1 T C 2: 168,210,552 T255A probably benign Het
Efhb A G 17: 53,445,775 Y440H probably damaging Het
Elp2 T C 18: 24,604,113 V40A probably damaging Het
Far2 A T 6: 148,175,131 N491Y possibly damaging Het
Frem1 T A 4: 82,950,280 H1488L probably benign Het
Frrs1l C A 4: 56,990,144 R43L unknown Het
Galnt3 G A 2: 66,107,088 R93C probably benign Het
Gm8225 A G 17: 26,543,389 T185A possibly damaging Het
H2-Q1 T C 17: 35,320,916 F54L probably benign Het
H2-Q1 A T 17: 35,321,079 Q108L probably damaging Het
Hoxc12 T G 15: 102,938,420 L249W probably damaging Het
Lrrc75b A T 10: 75,557,265 H83Q probably damaging Het
Muc4 A T 16: 32,756,017 T1964S unknown Het
Nob1 T C 8: 107,418,417 D142G probably benign Het
Olfr1155 A G 2: 87,943,227 Y134H probably damaging Het
Olfr1180 A T 2: 88,411,760 H299Q probably benign Het
Olfr1184 A T 2: 88,487,257 Y175F possibly damaging Het
Olfr1389 T C 11: 49,430,926 V150A probably benign Het
Olfr1449 G A 19: 12,935,277 D180N probably damaging Het
Patj A T 4: 98,441,090 N527I probably damaging Het
Pik3c2g A G 6: 139,859,370 I543V Het
Ppp1r2 A T 16: 31,258,461 N150K probably damaging Het
Prl7d1 A T 13: 27,710,178 L135Q probably damaging Het
Ralgds G T 2: 28,545,214 E461* probably null Het
Rasa3 T A 8: 13,605,887 H116L probably benign Het
Sec24d C T 3: 123,343,178 P520L probably damaging Het
Sfmbt1 T G 14: 30,796,326 S376A probably benign Het
Sspo A G 6: 48,481,239 T3290A probably benign Het
Stk25 G A 1: 93,624,624 P345S probably benign Het
Sycp2l A G 13: 41,146,672 E454G probably null Het
Tecpr1 T C 5: 144,214,067 K308E probably damaging Het
Thtpa C T 14: 55,095,505 P16S probably damaging Het
Trim65 T A 11: 116,127,709 I247F possibly damaging Het
Trpc6 T G 9: 8,610,148 Y206D probably benign Het
Ttn G A 2: 76,872,963 T9357I unknown Het
Ugt2b1 C A 5: 86,926,483 A6S probably benign Het
Vmn1r175 A G 7: 23,809,178 V8A possibly damaging Het
Vps13b T A 15: 35,878,825 I2990N probably damaging Het
Xirp2 G A 2: 67,515,482 R2689Q possibly damaging Het
Zfp831 T A 2: 174,646,723 Y1064N possibly damaging Het
Other mutations in Fam103a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02732:Fam103a1 APN 7 81767725 critical splice donor site probably null
R3545:Fam103a1 UTSW 7 81768522 unclassified probably null
R3753:Fam103a1 UTSW 7 81767647 missense probably damaging 1.00
R4665:Fam103a1 UTSW 7 81768430 missense probably damaging 1.00
R4784:Fam103a1 UTSW 7 81768415 missense probably damaging 0.99
R6378:Fam103a1 UTSW 7 81767639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACTGTTGAAGTGAATGCCTAC -3'
(R):5'- TCTGTGAGCAACTGTATTAAAGCTC -3'

Sequencing Primer
(F):5'- TGAAGTGAATGCCTACAATCTTAAG -3'
(R):5'- GAGCAACTGTATTAAAGCTCTCTTC -3'
Posted On2019-06-07