Incidental Mutation 'PIT4531001:Bmper'
ID556461
Institutional Source Beutler Lab
Gene Symbol Bmper
Ensembl Gene ENSMUSG00000031963
Gene NameBMP-binding endothelial regulator
SynonymsCV-2, Crim3, 3110056H04Rik, crossveinless-2, Cv2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4531001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location23223076-23485200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23224817 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 65 (N65Y)
Ref Sequence ENSEMBL: ENSMUSP00000071872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071982]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071982
AA Change: N65Y

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071872
Gene: ENSMUSG00000031963
AA Change: N65Y

DomainStartEndE-ValueType
VWC 50 105 1.57e-2 SMART
VWC 108 163 1.89e-1 SMART
VWC 166 224 7.27e-7 SMART
VWC 238 289 3.34e-6 SMART
VWC 301 357 1.7e-7 SMART
VWD 355 513 3.75e-41 SMART
C8 553 625 1.07e-14 SMART
Pfam:TIL 629 682 2.5e-13 PFAM
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.6%
  • 10x: 84.3%
  • 20x: 70.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted protein that contains five Von Willebrand factor type C domains and a Von Willebrand factor type D domain and a trypsin inhibitory-like domain. The encoded protein binds to bone morphogenetic proteins (BMP) and regulates their activity. Mutation of the related gene in humans causes diaphanospondylodysostosis. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a knock-out mutation exhibit neonatal lethality associated with abnormal lung and skeleton development. Mice heterozygous for a null allele exhibit abnromal lung development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk T G 9: 59,310,317 D204E probably damaging Het
Aqr C A 2: 114,130,734 V682L possibly damaging Het
Calb1 T C 4: 15,900,925 L171P probably damaging Het
Card11 T C 5: 140,906,660 M217V probably damaging Het
Col11a2 A G 17: 34,046,438 probably null Het
Dpm1 T C 2: 168,210,552 T255A probably benign Het
Efhb A G 17: 53,445,775 Y440H probably damaging Het
Elp2 T C 18: 24,604,113 V40A probably damaging Het
Fam103a1 C T 7: 81,767,579 P9L possibly damaging Het
Far2 A T 6: 148,175,131 N491Y possibly damaging Het
Frem1 T A 4: 82,950,280 H1488L probably benign Het
Frrs1l C A 4: 56,990,144 R43L unknown Het
Galnt3 G A 2: 66,107,088 R93C probably benign Het
Gm8225 A G 17: 26,543,389 T185A possibly damaging Het
H2-Q1 T C 17: 35,320,916 F54L probably benign Het
H2-Q1 A T 17: 35,321,079 Q108L probably damaging Het
Hoxc12 T G 15: 102,938,420 L249W probably damaging Het
Lrrc75b A T 10: 75,557,265 H83Q probably damaging Het
Muc4 A T 16: 32,756,017 T1964S unknown Het
Nob1 T C 8: 107,418,417 D142G probably benign Het
Olfr1155 A G 2: 87,943,227 Y134H probably damaging Het
Olfr1180 A T 2: 88,411,760 H299Q probably benign Het
Olfr1184 A T 2: 88,487,257 Y175F possibly damaging Het
Olfr1389 T C 11: 49,430,926 V150A probably benign Het
Olfr1449 G A 19: 12,935,277 D180N probably damaging Het
Patj A T 4: 98,441,090 N527I probably damaging Het
Pik3c2g A G 6: 139,859,370 I543V Het
Ppp1r2 A T 16: 31,258,461 N150K probably damaging Het
Prl7d1 A T 13: 27,710,178 L135Q probably damaging Het
Ralgds G T 2: 28,545,214 E461* probably null Het
Rasa3 T A 8: 13,605,887 H116L probably benign Het
Sec24d C T 3: 123,343,178 P520L probably damaging Het
Sfmbt1 T G 14: 30,796,326 S376A probably benign Het
Sspo A G 6: 48,481,239 T3290A probably benign Het
Stk25 G A 1: 93,624,624 P345S probably benign Het
Sycp2l A G 13: 41,146,672 E454G probably null Het
Tecpr1 T C 5: 144,214,067 K308E probably damaging Het
Thtpa C T 14: 55,095,505 P16S probably damaging Het
Trim65 T A 11: 116,127,709 I247F possibly damaging Het
Trpc6 T G 9: 8,610,148 Y206D probably benign Het
Ttn G A 2: 76,872,963 T9357I unknown Het
Ugt2b1 C A 5: 86,926,483 A6S probably benign Het
Vmn1r175 A G 7: 23,809,178 V8A possibly damaging Het
Vps13b T A 15: 35,878,825 I2990N probably damaging Het
Xirp2 G A 2: 67,515,482 R2689Q possibly damaging Het
Zfp831 T A 2: 174,646,723 Y1064N possibly damaging Het
Other mutations in Bmper
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Bmper APN 9 23406527 missense probably damaging 1.00
IGL00576:Bmper APN 9 23406603 missense probably damaging 1.00
IGL01115:Bmper APN 9 23399689 intron probably benign
IGL01978:Bmper APN 9 23381441 missense probably damaging 1.00
IGL02950:Bmper APN 9 23399494 missense probably damaging 1.00
IGL03193:Bmper APN 9 23366248 missense possibly damaging 0.46
PIT4469001:Bmper UTSW 9 23406549 missense probably benign 0.00
R0047:Bmper UTSW 9 23406686 missense probably damaging 1.00
R0047:Bmper UTSW 9 23406686 missense probably damaging 1.00
R0173:Bmper UTSW 9 23224829 missense probably benign 0.02
R0504:Bmper UTSW 9 23406687 missense probably damaging 1.00
R0550:Bmper UTSW 9 23373885 missense probably benign 0.01
R0722:Bmper UTSW 9 23373928 missense probably benign 0.00
R2254:Bmper UTSW 9 23381463 missense possibly damaging 0.81
R2255:Bmper UTSW 9 23381463 missense possibly damaging 0.81
R2863:Bmper UTSW 9 23483941 missense probably benign
R2865:Bmper UTSW 9 23483941 missense probably benign
R3841:Bmper UTSW 9 23473431 splice site probably null
R4056:Bmper UTSW 9 23399629 missense probably benign
R4105:Bmper UTSW 9 23224763 missense probably benign 0.00
R4108:Bmper UTSW 9 23224763 missense probably benign 0.00
R4352:Bmper UTSW 9 23483952 missense probably benign
R4824:Bmper UTSW 9 23223660 missense possibly damaging 0.77
R4909:Bmper UTSW 9 23377725 missense probably benign 0.07
R5356:Bmper UTSW 9 23373861 missense probably benign 0.01
R5379:Bmper UTSW 9 23297224 missense probably benign 0.42
R5666:Bmper UTSW 9 23473463 missense probably damaging 1.00
R5670:Bmper UTSW 9 23473463 missense probably damaging 1.00
R5883:Bmper UTSW 9 23406674 missense probably benign 0.28
R5963:Bmper UTSW 9 23375593 missense probably benign 0.03
R6312:Bmper UTSW 9 23406791 missense possibly damaging 0.46
R6768:Bmper UTSW 9 23381453 missense probably damaging 1.00
R6897:Bmper UTSW 9 23373929 missense probably benign 0.01
R6907:Bmper UTSW 9 23399572 missense probably damaging 1.00
R7220:Bmper UTSW 9 23399355 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGTGGTGCATTTGAAACAC -3'
(R):5'- GACGTCAAAGATAAGAATTCTCAGCC -3'

Sequencing Primer
(F):5'- AACACCACTAAGCAAGATTT -3'
(R):5'- GCCTGATGTGATATTAGAAATTGCCC -3'
Posted On2019-06-07