Incidental Mutation 'PIT4581001:Gabra5'
ID556504
Institutional Source Beutler Lab
Gene Symbol Gabra5
Ensembl Gene ENSMUSG00000055078
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 5
SynonymsA230018I05Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #PIT4581001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location57407672-57510059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57488857 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 148 (T148A)
Ref Sequence ENSEMBL: ENSMUSP00000063276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068456] [ENSMUST00000085240] [ENSMUST00000206382] [ENSMUST00000206734]
Predicted Effect probably damaging
Transcript: ENSMUST00000068456
AA Change: T148A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063276
Gene: ENSMUSG00000055078
AA Change: T148A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Neur_chan_LBD 49 257 3e-50 PFAM
Pfam:Neur_chan_memb 264 375 2.3e-33 PFAM
low complexity region 407 419 N/A INTRINSIC
transmembrane domain 432 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085240
SMART Domains Protein: ENSMUSP00000082337
Gene: ENSMUSG00000033676

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 5.1e-51 PFAM
Pfam:Neur_chan_memb 250 468 1.8e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206382
AA Change: T148A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206734
AA Change: T148A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. Transcript variants utilizing three different alternative non-coding first exons have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice having disruptions in this gene display abnormalities in hearing and in ear structure. Subtle abnormalities in learning and in conditioning have also been reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,343,832 H522R probably benign Het
Adcy8 A T 15: 64,754,817 I724N probably damaging Het
BC117090 T C 16: 36,322,932 I52V probably benign Het
Ctsj A T 13: 61,002,556 C210S probably damaging Het
Cyp2d12 A G 15: 82,558,451 E365G probably damaging Het
Dbi A T 1: 120,119,912 V85E probably damaging Het
Dhrs7b A G 11: 60,851,897 I153M possibly damaging Het
Dock10 C A 1: 80,505,446 C2096F probably damaging Het
Eid3 T A 10: 82,867,755 I350K probably damaging Het
Fam83b A T 9: 76,491,152 F890I probably damaging Het
Fras1 G A 5: 96,555,301 D308N probably benign Het
Ftsj3 T C 11: 106,249,476 D822G unknown Het
Gad1 A G 2: 70,599,667 D526G probably benign Het
Gm12184 A G 11: 48,826,144 I69T possibly damaging Het
Gm21698 T A 5: 25,987,352 T79S probably benign Het
Gon4l T G 3: 88,895,514 V1144G probably damaging Het
Ighv1-24 A T 12: 114,773,183 N32K probably benign Het
Islr T C 9: 58,157,201 N341S possibly damaging Het
Mybph A G 1: 134,194,741 T175A probably benign Het
Mycn T C 12: 12,940,243 K51E possibly damaging Het
Myh14 T C 7: 44,613,482 N1763D probably benign Het
Myrip T C 9: 120,467,517 S831P probably damaging Het
Neb G T 2: 52,288,802 A1314E probably damaging Het
Notch2 T C 3: 98,104,462 Y599H probably damaging Het
Npr1 C A 3: 90,462,257 G387V probably damaging Het
Olfr49 T A 14: 54,282,538 D119V probably damaging Het
Orai2 G A 5: 136,150,510 T223M probably damaging Het
Pcdhga5 A G 18: 37,696,857 E786G probably benign Het
Pde6b A G 5: 108,428,508 T749A probably benign Het
Pdzrn3 A G 6: 101,151,503 V734A probably benign Het
Pkd1l1 GCC GCCC 11: 8,916,298 probably null Het
Recql5 C A 11: 115,932,856 K21N possibly damaging Het
Rimbp3 G A 16: 17,210,716 S668N possibly damaging Het
Sdr42e1 A T 8: 117,663,518 I128N probably damaging Het
Shprh TAAAA T 10: 11,192,494 probably null Het
Slc15a2 A T 16: 36,772,043 C251S probably benign Het
Slc17a4 A T 13: 23,902,018 S329T probably damaging Het
Slc35a1 A G 4: 34,669,501 V246A possibly damaging Het
Slc37a2 A T 9: 37,237,405 S260R probably benign Het
Slco6d1 A T 1: 98,423,325 I177L possibly damaging Het
Tmcc1 A G 6: 116,043,456 V345A Het
Tmod2 T C 9: 75,597,301 Y12C probably damaging Het
Top2a A T 11: 99,002,964 W1035R probably damaging Het
Trpc1 A G 9: 95,736,921 S126P probably benign Het
Ttn A G 2: 76,733,961 S28576P probably damaging Het
Vmn1r16 A T 6: 57,322,873 W255R probably benign Het
Vmn2r5 T A 3: 64,503,927 K407* probably null Het
Vps13b G T 15: 35,534,263 W908C probably damaging Het
Ykt6 A G 11: 5,962,747 K150E possibly damaging Het
Zbtb2 A G 10: 4,369,265 Y254H possibly damaging Het
Zfp217 A G 2: 170,114,583 S832P probably benign Het
Zfp595 A G 13: 67,317,885 S108P probably benign Het
Zfp786 A T 6: 47,819,822 F727L probably damaging Het
Zzef1 G A 11: 72,899,672 V2151I probably benign Het
Other mutations in Gabra5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Gabra5 APN 7 57488988 missense probably damaging 1.00
IGL01475:Gabra5 APN 7 57408684 missense probably damaging 1.00
IGL02750:Gabra5 APN 7 57507991 missense probably benign 0.01
R0003:Gabra5 UTSW 7 57413728 missense probably damaging 1.00
R1519:Gabra5 UTSW 7 57408893 missense probably benign 0.39
R1740:Gabra5 UTSW 7 57421842 missense probably benign
R1766:Gabra5 UTSW 7 57508048 missense probably benign 0.05
R1865:Gabra5 UTSW 7 57489192 nonsense probably null
R2024:Gabra5 UTSW 7 57488950 missense probably damaging 1.00
R2143:Gabra5 UTSW 7 57489015 missense probably damaging 1.00
R2444:Gabra5 UTSW 7 57408875 missense probably benign
R2829:Gabra5 UTSW 7 57490835 missense probably benign
R2966:Gabra5 UTSW 7 57408641 missense probably damaging 0.99
R4014:Gabra5 UTSW 7 57489010 missense probably damaging 1.00
R4876:Gabra5 UTSW 7 57413665 missense probably damaging 1.00
R4936:Gabra5 UTSW 7 57408799 missense probably benign 0.32
R5217:Gabra5 UTSW 7 57490856 missense probably benign 0.00
R5360:Gabra5 UTSW 7 57490785 missense probably damaging 1.00
R6021:Gabra5 UTSW 7 57507992 missense probably benign 0.00
R6340:Gabra5 UTSW 7 57413748 missense probably damaging 1.00
R6351:Gabra5 UTSW 7 57413780 missense probably damaging 1.00
R6751:Gabra5 UTSW 7 57418334 missense probably damaging 1.00
R7267:Gabra5 UTSW 7 57490781 missense probably damaging 1.00
X0028:Gabra5 UTSW 7 57488911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACACCTCTGCAGCATGTG -3'
(R):5'- CAGACTGAATTAACTGTGGTGAGG -3'

Sequencing Primer
(F):5'- GCATGTGCAACCTTCAAATCATCTC -3'
(R):5'- ACTGAGATGTCCCCCTGATG -3'
Posted On2019-06-07