Incidental Mutation 'R0605:Phlpp2'
ID55651
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene NamePH domain and leucine rich repeat protein phosphatase 2
SynonymsC130044A18Rik, Phlppl
MMRRC Submission 038794-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R0605 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location109868542-109944671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109933211 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 721 (N721S)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
Predicted Effect probably benign
Transcript: ENSMUST00000034175
AA Change: N686S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732
AA Change: N686S

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149990
Predicted Effect probably benign
Transcript: ENSMUST00000179721
AA Change: N721S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: N721S

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 100% (85/85)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik G A 10: 20,311,227 probably benign Het
Adam28 A T 14: 68,606,600 probably benign Het
Adamts3 A G 5: 89,861,475 W110R possibly damaging Het
Add1 T C 5: 34,614,224 V342A possibly damaging Het
Aff3 A G 1: 38,209,987 S680P probably damaging Het
Ak9 T C 10: 41,345,139 Y322H probably damaging Het
Als2 A G 1: 59,168,414 L1528S probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp6v1a A C 16: 44,111,496 probably null Het
Bpi T C 2: 158,261,394 L103P probably damaging Het
Cd80 G A 16: 38,482,694 V168I probably benign Het
Cfh T C 1: 140,102,358 S926G probably damaging Het
Chrd A T 16: 20,735,439 T304S probably damaging Het
Chsy3 A G 18: 59,409,053 Y421C probably damaging Het
Cmbl T G 15: 31,585,309 V101G probably damaging Het
Colgalt2 T A 1: 152,495,792 probably benign Het
Coq4 C T 2: 29,789,998 Q101* probably null Het
Cr2 T C 1: 195,163,596 probably benign Het
Cry1 T C 10: 85,184,359 D38G probably damaging Het
Dmxl2 T C 9: 54,419,945 D758G probably benign Het
Epsti1 C T 14: 77,927,237 probably benign Het
Fam24b T C 7: 131,327,186 probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Foxred1 T C 9: 35,204,882 Y490C possibly damaging Het
Gm14124 A G 2: 150,268,603 I404M unknown Het
Gm9875 A G 2: 13,557,888 K9R unknown Het
Grid2ip T C 5: 143,379,362 S322P probably damaging Het
Gucy1b2 A G 14: 62,403,159 probably benign Het
Hmcn1 A T 1: 150,657,376 probably null Het
Hpdl C T 4: 116,820,787 S159N possibly damaging Het
Hsd17b12 A T 2: 94,033,642 M285K probably benign Het
Icam5 T C 9: 21,032,197 I23T probably benign Het
Kat5 A G 19: 5,608,336 probably benign Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lamb2 T C 9: 108,486,105 probably benign Het
Lgals3bp A G 11: 118,393,394 F453S probably damaging Het
Lypd4 A G 7: 24,865,375 Y113H probably damaging Het
Mdm1 C T 10: 118,146,601 T47M probably damaging Het
Mei1 C A 15: 82,070,150 T52K probably benign Het
Meiob G A 17: 24,818,262 probably benign Het
Ndufaf6 A G 4: 11,051,224 V292A probably damaging Het
Neb T A 2: 52,264,026 M2358L possibly damaging Het
Nlrp1b A G 11: 71,156,179 S1119P possibly damaging Het
Nsmaf A G 4: 6,418,470 probably null Het
Ogfod1 T C 8: 94,047,267 probably benign Het
Olfr1097 T C 2: 86,890,419 Y252C possibly damaging Het
Olfr1410 G T 1: 92,607,896 V20L probably benign Het
Olfr291 T C 7: 84,857,137 I256T probably damaging Het
Osbpl1a T A 18: 12,882,279 probably null Het
Otud7b T A 3: 96,144,959 probably benign Het
P3h3 T A 6: 124,856,035 H185L probably damaging Het
P4htm G A 9: 108,583,724 A183V probably null Het
Peak1 C T 9: 56,227,098 probably benign Het
Phf20l1 A G 15: 66,595,122 K88R probably damaging Het
Plagl2 T C 2: 153,235,944 K39R probably benign Het
Plppr1 A T 4: 49,323,466 N252I probably damaging Het
Pom121l2 C T 13: 21,982,036 A159V probably damaging Het
Prom2 C A 2: 127,539,995 probably null Het
Prrc2c T C 1: 162,682,426 T1017A probably damaging Het
Rimbp3 G T 16: 17,211,699 A996S probably damaging Het
Rnf213 A G 11: 119,431,717 T1387A probably benign Het
Scaper A T 9: 55,815,518 probably benign Het
Scara5 A G 14: 65,759,648 E403G possibly damaging Het
Scrib T C 15: 76,067,553 I94V possibly damaging Het
Shank3 T C 15: 89,524,147 F67L possibly damaging Het
Shprh T C 10: 11,207,112 F1562L probably damaging Het
Src C T 2: 157,469,921 T529M probably damaging Het
Sycp2l T A 13: 41,143,466 M341K probably benign Het
Syde1 T C 10: 78,589,095 probably benign Het
Tarsl2 A T 7: 65,678,071 R509S probably damaging Het
Tle6 T A 10: 81,594,346 H324L probably damaging Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably benign Het
Tnfrsf14 T A 4: 154,925,380 K115* probably null Het
Trappc10 T C 10: 78,201,497 N824S possibly damaging Het
Tsc1 C T 2: 28,671,778 S309F probably damaging Het
Ttc21a A G 9: 119,961,842 I885V possibly damaging Het
Ttn C T 2: 76,740,453 A26699T probably damaging Het
Ttn T C 2: 76,948,371 Y1262C unknown Het
Usp49 T C 17: 47,674,926 probably null Het
Vmn1r226 A T 17: 20,687,871 T122S probably benign Het
Vps8 A T 16: 21,559,337 T1033S probably benign Het
Vwf C A 6: 125,685,837 T2728K probably benign Het
Wdr5b T C 16: 36,041,996 S162P probably benign Het
Xrn1 C T 9: 96,026,877 Q1235* probably null Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 109925790 missense probably benign 0.01
IGL01363:Phlpp2 APN 8 109937097 missense probably benign 0.22
IGL01535:Phlpp2 APN 8 109934065 missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 109939859 missense probably benign
IGL02105:Phlpp2 APN 8 109904408 missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 109920099 missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 109939873 missense probably benign 0.04
IGL02500:Phlpp2 APN 8 109913618 missense probably benign
IGL03356:Phlpp2 APN 8 109935617 missense probably benign 0.00
IGL03366:Phlpp2 APN 8 109940835 missense probably benign 0.44
R0142:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0144:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 109939935 missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 109928463 missense probably benign 0.01
R0477:Phlpp2 UTSW 8 109895506 critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 109876971 missense probably benign 0.00
R0655:Phlpp2 UTSW 8 109895587 missense probably benign 0.00
R0833:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 109877030 nonsense probably null
R1417:Phlpp2 UTSW 8 109940681 nonsense probably null
R1602:Phlpp2 UTSW 8 109934023 missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 109933955 splice site probably benign
R1815:Phlpp2 UTSW 8 109940223 missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 109907600 missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 109940002 missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 109907613 missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 109876883 missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 109940820 missense probably benign 0.31
R4739:Phlpp2 UTSW 8 109940420 missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 109877010 missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 109940082 missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 109913619 missense probably benign 0.04
R5074:Phlpp2 UTSW 8 109925829 missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 109934035 missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 109904344 missense probably benign 0.01
R5668:Phlpp2 UTSW 8 109928573 missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 109934685 missense probably benign
R6470:Phlpp2 UTSW 8 109937194 missense probably benign 0.45
R6804:Phlpp2 UTSW 8 109928565 missense probably damaging 1.00
X0018:Phlpp2 UTSW 8 109912369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGATGGTGAACTGAGCATGG -3'
(R):5'- TGAGGGGAAGCAATCTCATTCACAC -3'

Sequencing Primer
(F):5'- AACTGAGCATGGCTGATATCTG -3'
(R):5'- GAAGCAATCTCATTCACACTCCTTG -3'
Posted On2013-07-11