Incidental Mutation 'PIT4651001:Jag1'
ID556644
Institutional Source Beutler Lab
Gene Symbol Jag1
Ensembl Gene ENSMUSG00000027276
Gene Namejagged 1
SynonymsABE2, Gsfabe2, Serrate-1, Htu, Ozz, Headturner
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4651001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location137081456-137116644 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 137101697 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 193 (G193D)
Ref Sequence ENSEMBL: ENSMUSP00000028735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028735]
Predicted Effect probably damaging
Transcript: ENSMUST00000028735
AA Change: G193D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028735
Gene: ENSMUSG00000027276
AA Change: G193D

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:MNNL 31 109 2.8e-31 PFAM
DSL 167 229 1.85e-37 SMART
EGF 233 263 1.66e1 SMART
EGF 264 294 2.25e1 SMART
EGF_CA 296 334 4.42e-7 SMART
EGF 339 372 2.64e-5 SMART
EGF_CA 374 410 2.89e-11 SMART
EGF_CA 412 448 2.8e-9 SMART
EGF_CA 450 485 2.31e-10 SMART
EGF_CA 487 523 1.69e-12 SMART
EGF_CA 525 561 4.19e-8 SMART
EGF 577 627 2.16e-1 SMART
EGF_CA 629 665 2.56e-12 SMART
EGF_CA 667 703 6.91e-9 SMART
EGF 708 741 5.88e-3 SMART
EGF 747 780 9.62e-8 SMART
EGF_CA 782 818 3.59e-7 SMART
EGF_CA 820 856 3.81e-11 SMART
VWC 863 930 4.79e-16 SMART
transmembrane domain 1069 1091 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 70.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The jagged 1 protein encoded by JAG1 is the human homolog of the Drosophilia jagged protein. Human jagged 1 is the ligand for the receptor notch 1, the latter a human homolog of the Drosophilia jagged receptor notch. Mutations that alter the jagged 1 protein cause Alagille syndrome. Jagged 1 signalling through notch 1 has also been shown to play a role in hematopoiesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit extensive hemorrhaging and die prior to embryonic day 11.5, while heterozygotes exhibit defects of the eye. Heterozygotes for missense mutations have inner ear abnormalities. Other mutant mice display abnormal head movements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,259,895 I428L probably benign Het
Aass T C 6: 23,118,751 I131V probably benign Het
Alcam T A 16: 52,295,187 K189N probably benign Het
Ankrd50 C A 3: 38,455,810 E803* probably null Het
Ankrd53 A G 6: 83,765,733 D236G probably damaging Het
Bard1 A G 1: 71,074,928 V298A probably benign Het
Cacna1d C T 14: 30,178,645 G361D probably damaging Het
Camkk1 A G 11: 73,025,821 S82G probably benign Het
Ccr4 A T 9: 114,492,193 V268E probably benign Het
Cdh6 G A 15: 13,044,719 S439L possibly damaging Het
Ces1e G T 8: 93,215,083 A254E probably benign Het
Cfap46 T C 7: 139,645,551 T1078A Het
Cyp46a1 A G 12: 108,353,108 D288G probably benign Het
Dnah6 T C 6: 73,060,260 N3333S probably benign Het
Dzip3 A G 16: 48,944,878 V491A probably benign Het
Egr1 G T 18: 34,863,187 E341* probably null Het
Enpp1 G A 10: 24,653,950 P597S probably benign Het
Ercc3 A T 18: 32,240,312 probably benign Het
Fam160a1 C T 3: 85,683,641 A389T probably damaging Het
Fbn1 T C 2: 125,363,989 probably null Het
Fbxw11 T C 11: 32,711,999 probably null Het
Gbf1 A G 19: 46,163,543 N5S probably benign Het
Gbp4 T A 5: 105,118,423 H584L probably benign Het
Gcgr G T 11: 120,538,142 C402F probably damaging Het
Gm3550 A T 18: 34,737,839 Q142L unknown Het
Grm7 T A 6: 110,646,089 N74K probably benign Het
Hils1 A G 11: 94,968,316 S146G probably benign Het
Hoxa10 T G 6: 52,234,897 N13T possibly damaging Het
Ice1 A T 13: 70,623,921 probably null Het
Il22 C A 10: 118,205,590 N69K probably damaging Het
Il9r A T 11: 32,191,798 H319Q probably benign Het
Itgax A G 7: 128,149,110 T1104A probably benign Het
Krt13 T A 11: 100,120,036 D164V probably damaging Het
Lepr T C 4: 101,791,997 M865T probably damaging Het
Lmf2 G A 15: 89,352,069 H576Y possibly damaging Het
Lrrc8c C T 5: 105,608,323 H655Y probably benign Het
Mapk6 A T 9: 75,397,587 S183T possibly damaging Het
Mcrs1 A T 15: 99,246,951 Y261N probably damaging Het
Mon1b G A 8: 113,638,622 G194D probably benign Het
Myo18b C T 5: 112,834,435 R1144Q probably benign Het
Myo9b T A 8: 71,342,812 H808Q possibly damaging Het
Ngdn T C 14: 55,016,200 I15T probably benign Het
Nhsl1 T G 10: 18,408,435 S41R probably damaging Het
Numa1 A T 7: 102,013,934 K2089M probably damaging Het
Obscn A G 11: 59,041,681 L4900P probably damaging Het
Olfm4 T A 14: 80,021,485 L391Q probably benign Het
Olfr1034 T C 2: 86,046,518 L12P probably damaging Het
Olfr1459 T A 19: 13,146,627 I11F probably benign Het
Olfr1465 A G 19: 13,314,192 I31T probably benign Het
Olfr705 A G 7: 106,873,523 C241R probably damaging Het
Olfr980 A T 9: 40,006,230 C240S probably damaging Het
Park2 T A 17: 11,067,243 L41Q probably damaging Het
Parn T A 16: 13,631,567 N302Y probably benign Het
Pi4k2b T G 5: 52,748,470 S118A possibly damaging Het
Piwil4 C T 9: 14,708,899 V704I possibly damaging Het
Pm20d2 G A 4: 33,181,715 T296M probably damaging Het
Pmpcb C T 5: 21,746,050 A270V probably benign Het
Pnpt1 T C 11: 29,156,945 probably null Het
Rc3h1 C A 1: 160,963,540 N931K probably benign Het
Rlf A G 4: 121,150,313 V600A probably damaging Het
Rnf219 T A 14: 104,506,256 D129V probably damaging Het
Sall1 T G 8: 89,031,103 Q791P probably damaging Het
Sema3c T A 5: 17,694,733 Y408N probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Tmem181a A T 17: 6,300,895 M319L probably benign Het
Trim24 T C 6: 37,900,732 probably null Het
Ttn T A 2: 76,888,934 T7234S unknown Het
Unc13c T A 9: 73,483,739 M2076L possibly damaging Het
Uroc1 C T 6: 90,363,113 R667* probably null Het
Uvrag A G 7: 98,906,520 F456L probably benign Het
Vmn1r215 T C 13: 23,076,360 V190A probably damaging Het
Vmn2r50 T A 7: 10,037,732 T681S probably benign Het
Vmn2r65 T A 7: 84,946,253 T408S probably benign Het
Vps33b A G 7: 80,290,007 D502G probably damaging Het
Other mutations in Jag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Jag1 APN 2 137086032 critical splice acceptor site probably null
IGL00912:Jag1 APN 2 137115573 missense probably damaging 1.00
IGL01104:Jag1 APN 2 137084378 missense probably benign 0.40
IGL01529:Jag1 APN 2 137084977 missense probably damaging 0.99
IGL01578:Jag1 APN 2 137100051 splice site probably benign
IGL01720:Jag1 APN 2 137087103 missense probably damaging 1.00
IGL01809:Jag1 APN 2 137115484 missense probably damaging 1.00
IGL02402:Jag1 APN 2 137085938 missense possibly damaging 0.79
IGL02434:Jag1 APN 2 137087155 missense probably benign 0.01
IGL02543:Jag1 APN 2 137091947 splice site probably benign
IGL02650:Jag1 APN 2 137115585 missense possibly damaging 0.95
IGL03010:Jag1 APN 2 137093198 splice site probably benign
IGL03102:Jag1 APN 2 137084688 missense probably benign 0.00
Grenville UTSW 2 137087142 missense probably damaging 1.00
R0227:Jag1 UTSW 2 137115618 missense probably benign
R0306:Jag1 UTSW 2 137085935 missense probably damaging 1.00
R0325:Jag1 UTSW 2 137095445 critical splice donor site probably null
R0594:Jag1 UTSW 2 137087080 missense probably damaging 0.99
R0838:Jag1 UTSW 2 137093278 missense probably damaging 0.98
R0879:Jag1 UTSW 2 137100081 missense possibly damaging 0.80
R0900:Jag1 UTSW 2 137090882 frame shift probably null
R0972:Jag1 UTSW 2 137083451 missense possibly damaging 0.64
R1083:Jag1 UTSW 2 137096232 missense probably damaging 0.99
R1182:Jag1 UTSW 2 137091489 missense probably benign 0.36
R1292:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1464:Jag1 UTSW 2 137115648 missense probably damaging 0.98
R1464:Jag1 UTSW 2 137115648 missense probably damaging 0.98
R1500:Jag1 UTSW 2 137115638 missense possibly damaging 0.82
R1936:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1937:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1939:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1998:Jag1 UTSW 2 137090938 missense probably damaging 1.00
R2019:Jag1 UTSW 2 137084679 missense probably benign 0.37
R2213:Jag1 UTSW 2 137089892 missense probably benign 0.01
R2300:Jag1 UTSW 2 137096315 missense probably damaging 1.00
R2484:Jag1 UTSW 2 137084700 missense possibly damaging 0.86
R4179:Jag1 UTSW 2 137101658 missense probably damaging 0.99
R4212:Jag1 UTSW 2 137085070 missense probably benign
R4630:Jag1 UTSW 2 137085979 missense probably damaging 1.00
R4701:Jag1 UTSW 2 137094456 missense probably benign 0.11
R4705:Jag1 UTSW 2 137096309 missense probably damaging 1.00
R4904:Jag1 UTSW 2 137087142 missense probably damaging 1.00
R5050:Jag1 UTSW 2 137085154 missense possibly damaging 0.71
R5288:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5367:Jag1 UTSW 2 137085094 missense possibly damaging 0.90
R5385:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5386:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5430:Jag1 UTSW 2 137101706 missense possibly damaging 0.94
R5472:Jag1 UTSW 2 137084995 missense probably damaging 1.00
R5755:Jag1 UTSW 2 137088690 missense probably damaging 1.00
R5764:Jag1 UTSW 2 137089247 missense probably damaging 1.00
R5804:Jag1 UTSW 2 137088204 missense probably benign 0.01
R6406:Jag1 UTSW 2 137087643 missense probably damaging 1.00
R6503:Jag1 UTSW 2 137101629 missense probably damaging 1.00
R6721:Jag1 UTSW 2 137094474 missense probably benign 0.00
R6826:Jag1 UTSW 2 137116175 critical splice donor site probably null
R7055:Jag1 UTSW 2 137115489 missense probably benign 0.26
R7214:Jag1 UTSW 2 137106882 missense probably benign 0.00
Z1088:Jag1 UTSW 2 137085151 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGAGAACCTGGTACCCAAACTG -3'
(R):5'- TCCGAAAGTAGGCAAAATGGTC -3'

Sequencing Primer
(F):5'- CTGATAAGCCAACATCATTTGCAG -3'
(R):5'- TCGGAAGATGCTTATGTGACTG -3'
Posted On2019-06-07