Incidental Mutation 'PIT4802001:Tbck'
ID556717
Institutional Source Beutler Lab
Gene Symbol Tbck
Ensembl Gene ENSMUSG00000028030
Gene NameTBC1 domain containing kinase
SynonymsA630047E20Rik, C030007I09Rik, 1700120J03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #PIT4802001 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location132684144-132841688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 132752666 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 686 (P686S)
Ref Sequence ENSEMBL: ENSMUSP00000129205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169172]
Predicted Effect probably damaging
Transcript: ENSMUST00000169172
AA Change: P686S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129205
Gene: ENSMUSG00000028030
AA Change: P686S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 270 4.5e-29 PFAM
Pfam:Pkinase 32 273 1.4e-39 PFAM
Blast:TBC 366 450 5e-34 BLAST
TBC 463 674 5.27e-46 SMART
RHOD 780 886 2.67e-13 SMART
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.0%
  • 10x: 85.4%
  • 20x: 73.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a protein kinase domain, a Rhodanase-like domain and the Tre-2/Bub2/Cdc16 (TBC) domain. The encoded protein is thought to play a role in actin organization, cell growth and cell proliferation by regulating the mammalian target of the rapamycin (mTOR) signaling pathway. This protein may also be involved in the transcriptional regulation of the components of the mTOR complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,346 D741E probably benign Het
Abca16 A G 7: 120,540,128 D1461G probably benign Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
Akap5 T C 12: 76,329,932 Y713H probably damaging Het
AW554918 A G 18: 25,340,075 E312G possibly damaging Het
Car4 G A 11: 84,964,405 A157T probably damaging Het
Chst9 A T 18: 15,452,792 M238K probably benign Het
Ctbp2 G A 7: 132,988,245 H397Y possibly damaging Het
Cyp3a59 A G 5: 146,102,801 M295V probably benign Het
Daglb T C 5: 143,503,048 Y586H probably benign Het
Ehbp1l1 G T 19: 5,719,575 P567T possibly damaging Het
Emilin2 A G 17: 71,273,469 I754T probably damaging Het
Esyt2 G A 12: 116,365,837 A672T probably benign Het
Evx1 G T 6: 52,314,190 E116* probably null Het
Exph5 T C 9: 53,374,978 S1120P probably damaging Het
Fam184a A T 10: 53,684,354 L515* probably null Het
Flt4 T A 11: 49,633,169 D525E probably benign Het
Galt T C 4: 41,756,764 W135R probably damaging Het
Ifitm6 A T 7: 141,016,735 C42S probably damaging Het
Ift172 A G 5: 31,285,266 S186P probably benign Het
Kcnk3 A G 5: 30,622,368 E254G probably damaging Het
Kmt2b A G 7: 30,579,571 S1509P probably damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lrba T A 3: 86,664,494 Y2368* probably null Het
Mtmr4 T A 11: 87,611,127 V669E probably benign Het
Myh10 C T 11: 68,765,092 R471C probably damaging Het
Nav1 G A 1: 135,452,933 T1416I unknown Het
Nrip1 A C 16: 76,293,269 S467A probably damaging Het
Ntrk1 T A 3: 87,788,634 N190Y probably damaging Het
Olfr193 A C 16: 59,110,601 M3R probably benign Het
Olfr294 A T 7: 86,616,555 L30Q probably null Het
Pdxp A G 15: 78,918,411 S282G probably damaging Het
Phtf2 A T 5: 20,801,906 S220T probably damaging Het
Piezo2 A T 18: 63,024,469 V2390E probably damaging Het
Pop1 T G 15: 34,529,083 L783R probably benign Het
Prf1 G A 10: 61,300,193 A83T probably benign Het
Rab4b A G 7: 27,175,842 V50A probably benign Het
Rtn1 T A 12: 72,304,326 T370S probably benign Het
Sdr16c5 T A 4: 4,012,423 I123F probably damaging Het
Smg6 T A 11: 75,156,165 V1228D probably damaging Het
Smim19 A G 8: 22,473,523 V23A probably benign Het
Sox13 A T 1: 133,386,258 I346N probably damaging Het
Tap1 T A 17: 34,193,191 Y457N probably damaging Het
Tcof1 A G 18: 60,831,938 S570P unknown Het
Tmc5 A T 7: 118,672,226 M921L probably benign Het
Ttc6 A G 12: 57,725,676 Y1594C possibly damaging Het
Virma T A 4: 11,546,008 H1615Q probably damaging Het
Vmn1r19 T A 6: 57,405,052 Y197N probably damaging Het
Vps13c T C 9: 67,937,786 F2051L probably damaging Het
Wdr6 C T 9: 108,574,566 C706Y probably damaging Het
Zfand4 A G 6: 116,284,775 N100D probably damaging Het
Other mutations in Tbck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Tbck APN 3 132743093 splice site probably null
IGL00492:Tbck APN 3 132722740 missense probably benign 0.00
IGL01020:Tbck APN 3 132727142 nonsense probably null
IGL01111:Tbck APN 3 132694407 missense probably damaging 1.00
IGL01299:Tbck APN 3 132724877 missense probably damaging 0.98
IGL02456:Tbck APN 3 132734714 splice site probably benign
IGL02554:Tbck APN 3 132751192 nonsense probably null
IGL02640:Tbck APN 3 132774486 missense probably benign 0.26
IGL02960:Tbck APN 3 132722783 missense probably benign 0.01
IGL03184:Tbck APN 3 132736103 missense probably damaging 1.00
IGL03246:Tbck APN 3 132774570 missense probably benign
fear-4 UTSW 3 132724916 critical splice donor site probably null
fuerchte UTSW 3 132722291 splice site probably benign
PIT1430001:Tbck UTSW 3 132722726 missense probably benign
R0113:Tbck UTSW 3 132743080 missense probably damaging 1.00
R0241:Tbck UTSW 3 132724875 missense probably benign
R0241:Tbck UTSW 3 132724875 missense probably benign
R0309:Tbck UTSW 3 132734407 nonsense probably null
R0375:Tbck UTSW 3 132751232 splice site probably benign
R0571:Tbck UTSW 3 132752642 missense probably damaging 1.00
R0831:Tbck UTSW 3 132722291 splice site probably benign
R1135:Tbck UTSW 3 132732191 missense probably damaging 0.97
R1184:Tbck UTSW 3 132837972 missense probably benign 0.01
R1560:Tbck UTSW 3 132838048 missense probably damaging 1.00
R1563:Tbck UTSW 3 132715693 missense possibly damaging 0.94
R1659:Tbck UTSW 3 132734355 missense probably damaging 1.00
R1799:Tbck UTSW 3 132774502 missense probably benign 0.01
R1830:Tbck UTSW 3 132838011 missense probably benign 0.40
R1884:Tbck UTSW 3 132724916 critical splice donor site probably null
R3406:Tbck UTSW 3 132727084 missense probably benign 0.41
R4021:Tbck UTSW 3 132727134 missense probably damaging 0.97
R4205:Tbck UTSW 3 132838028 missense probably benign 0.32
R4503:Tbck UTSW 3 132751220 missense probably benign 0.03
R4794:Tbck UTSW 3 132686968 missense possibly damaging 0.90
R4795:Tbck UTSW 3 132707798 missense possibly damaging 0.95
R4859:Tbck UTSW 3 132801527 missense probably benign 0.00
R5282:Tbck UTSW 3 132751216 missense possibly damaging 0.95
R5787:Tbck UTSW 3 132737568 missense probably damaging 1.00
R5987:Tbck UTSW 3 132801517 missense possibly damaging 0.53
R6145:Tbck UTSW 3 132732215 missense probably damaging 1.00
R6147:Tbck UTSW 3 132694446 missense probably benign
R6242:Tbck UTSW 3 132694428 missense probably benign 0.16
R6276:Tbck UTSW 3 132743005 missense probably damaging 1.00
R6912:Tbck UTSW 3 132686942 missense possibly damaging 0.50
R7107:Tbck UTSW 3 132722331 missense possibly damaging 0.73
R7191:Tbck UTSW 3 132737555 missense probably damaging 1.00
X0018:Tbck UTSW 3 132686800 start codon destroyed probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACTGTCAAGCATTTTATCAGCAC -3'
(R):5'- CTCAGTATGACCCGAGTTAGCC -3'

Sequencing Primer
(F):5'- CAAGCATTTTATCAGCACAGTTTAAC -3'
(R):5'- GAGTTAGCCTCTCATTCTCAGG -3'
Posted On2019-06-07