Incidental Mutation 'PIT4802001:Wdr6'
ID556740
Institutional Source Beutler Lab
Gene Symbol Wdr6
Ensembl Gene ENSMUSG00000066357
Gene NameWD repeat domain 6
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.391) question?
Stock #PIT4802001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108572311-108578739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108574566 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 706 (C706Y)
Ref Sequence ENSEMBL: ENSMUSP00000070927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006853] [ENSMUST00000019183] [ENSMUST00000068700] [ENSMUST00000193427] [ENSMUST00000195249]
Predicted Effect probably benign
Transcript: ENSMUST00000006853
SMART Domains Protein: ENSMUSP00000006853
Gene: ENSMUSG00000006675

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
P4Hc 143 460 1.26e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019183
SMART Domains Protein: ENSMUSP00000019183
Gene: ENSMUSG00000019039

DomainStartEndE-ValueType
low complexity region 288 301 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
DALR_1 399 538 2.09e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068700
AA Change: C706Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070927
Gene: ENSMUSG00000066357
AA Change: C706Y

DomainStartEndE-ValueType
Blast:WD40 109 142 3e-6 BLAST
WD40 198 237 1.42e-4 SMART
WD40 247 284 7.28e-2 SMART
WD40 286 326 1.72e-3 SMART
Blast:WD40 336 375 3e-13 BLAST
WD40 479 519 2.96e1 SMART
low complexity region 537 552 N/A INTRINSIC
WD40 559 598 1.77e2 SMART
Blast:WD40 600 641 7e-20 BLAST
Blast:WD40 764 815 2e-22 BLAST
Blast:WD40 855 896 2e-11 BLAST
WD40 900 949 1.48e1 SMART
WD40 973 1015 5.52e-2 SMART
WD40 1035 1076 3.98e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192518
Predicted Effect probably benign
Transcript: ENSMUST00000193427
SMART Domains Protein: ENSMUSP00000141748
Gene: ENSMUSG00000019039

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
DALR_1 68 171 1.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195249
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.0%
  • 10x: 85.4%
  • 20x: 73.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. The encoded protein interacts with serine/threonine kinase 11, and is implicated in cell growth arrest. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,346 D741E probably benign Het
Abca16 A G 7: 120,540,128 D1461G probably benign Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
Akap5 T C 12: 76,329,932 Y713H probably damaging Het
AW554918 A G 18: 25,340,075 E312G possibly damaging Het
Car4 G A 11: 84,964,405 A157T probably damaging Het
Chst9 A T 18: 15,452,792 M238K probably benign Het
Ctbp2 G A 7: 132,988,245 H397Y possibly damaging Het
Cyp3a59 A G 5: 146,102,801 M295V probably benign Het
Daglb T C 5: 143,503,048 Y586H probably benign Het
Ehbp1l1 G T 19: 5,719,575 P567T possibly damaging Het
Emilin2 A G 17: 71,273,469 I754T probably damaging Het
Esyt2 G A 12: 116,365,837 A672T probably benign Het
Evx1 G T 6: 52,314,190 E116* probably null Het
Exph5 T C 9: 53,374,978 S1120P probably damaging Het
Fam184a A T 10: 53,684,354 L515* probably null Het
Flt4 T A 11: 49,633,169 D525E probably benign Het
Galt T C 4: 41,756,764 W135R probably damaging Het
Ifitm6 A T 7: 141,016,735 C42S probably damaging Het
Ift172 A G 5: 31,285,266 S186P probably benign Het
Kcnk3 A G 5: 30,622,368 E254G probably damaging Het
Kmt2b A G 7: 30,579,571 S1509P probably damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lrba T A 3: 86,664,494 Y2368* probably null Het
Mtmr4 T A 11: 87,611,127 V669E probably benign Het
Myh10 C T 11: 68,765,092 R471C probably damaging Het
Nav1 G A 1: 135,452,933 T1416I unknown Het
Nrip1 A C 16: 76,293,269 S467A probably damaging Het
Ntrk1 T A 3: 87,788,634 N190Y probably damaging Het
Olfr193 A C 16: 59,110,601 M3R probably benign Het
Olfr294 A T 7: 86,616,555 L30Q probably null Het
Pdxp A G 15: 78,918,411 S282G probably damaging Het
Phtf2 A T 5: 20,801,906 S220T probably damaging Het
Piezo2 A T 18: 63,024,469 V2390E probably damaging Het
Pop1 T G 15: 34,529,083 L783R probably benign Het
Prf1 G A 10: 61,300,193 A83T probably benign Het
Rab4b A G 7: 27,175,842 V50A probably benign Het
Rtn1 T A 12: 72,304,326 T370S probably benign Het
Sdr16c5 T A 4: 4,012,423 I123F probably damaging Het
Smg6 T A 11: 75,156,165 V1228D probably damaging Het
Smim19 A G 8: 22,473,523 V23A probably benign Het
Sox13 A T 1: 133,386,258 I346N probably damaging Het
Tap1 T A 17: 34,193,191 Y457N probably damaging Het
Tbck C T 3: 132,752,666 P686S probably damaging Het
Tcof1 A G 18: 60,831,938 S570P unknown Het
Tmc5 A T 7: 118,672,226 M921L probably benign Het
Ttc6 A G 12: 57,725,676 Y1594C possibly damaging Het
Virma T A 4: 11,546,008 H1615Q probably damaging Het
Vmn1r19 T A 6: 57,405,052 Y197N probably damaging Het
Vps13c T C 9: 67,937,786 F2051L probably damaging Het
Zfand4 A G 6: 116,284,775 N100D probably damaging Het
Other mutations in Wdr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Wdr6 APN 9 108574897 missense possibly damaging 0.77
IGL01757:Wdr6 APN 9 108576228 missense possibly damaging 0.65
IGL02096:Wdr6 APN 9 108576553 missense probably damaging 1.00
IGL02577:Wdr6 APN 9 108575941 missense possibly damaging 0.88
IGL02625:Wdr6 APN 9 108575505 missense probably damaging 1.00
IGL02820:Wdr6 APN 9 108578544 missense probably benign 0.28
IGL03250:Wdr6 APN 9 108573197 missense possibly damaging 0.95
R0038:Wdr6 UTSW 9 108572969 missense probably damaging 1.00
R0153:Wdr6 UTSW 9 108575242 missense probably damaging 1.00
R0378:Wdr6 UTSW 9 108575864 missense probably damaging 1.00
R0420:Wdr6 UTSW 9 108573101 missense probably benign 0.41
R1620:Wdr6 UTSW 9 108574655 missense possibly damaging 0.51
R1753:Wdr6 UTSW 9 108575164 missense probably damaging 0.99
R1844:Wdr6 UTSW 9 108575977 missense probably damaging 1.00
R1881:Wdr6 UTSW 9 108573179 unclassified probably null
R1987:Wdr6 UTSW 9 108576534 missense probably damaging 1.00
R2029:Wdr6 UTSW 9 108575355 missense probably damaging 1.00
R2139:Wdr6 UTSW 9 108574123 missense probably benign 0.00
R3900:Wdr6 UTSW 9 108575769 missense probably damaging 1.00
R4021:Wdr6 UTSW 9 108575206 missense probably damaging 1.00
R4909:Wdr6 UTSW 9 108572988 missense probably benign 0.28
R5073:Wdr6 UTSW 9 108574366 missense probably damaging 1.00
R5748:Wdr6 UTSW 9 108575782 missense possibly damaging 0.75
R6039:Wdr6 UTSW 9 108573795 frame shift probably null
R6039:Wdr6 UTSW 9 108573795 frame shift probably null
R6254:Wdr6 UTSW 9 108574911 missense probably damaging 1.00
R6724:Wdr6 UTSW 9 108574894 missense probably benign 0.11
R7134:Wdr6 UTSW 9 108573365 missense probably damaging 1.00
R7248:Wdr6 UTSW 9 108576039 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTCGCACAGAGGAGATATGG -3'
(R):5'- GAGAAGCTGCATATCGTCAACTG -3'

Sequencing Primer
(F):5'- CTCGCACAGAGGAGATATGGTTACAG -3'
(R):5'- CTGCATATCGTCAACTGTGGGG -3'
Posted On2019-06-07