Incidental Mutation 'PIT4802001:Chst9'
ID556760
Institutional Source Beutler Lab
Gene Symbol Chst9
Ensembl Gene ENSMUSG00000047161
Gene Namecarbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
Synonyms5430438D01Rik, GalNAc4ST-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #PIT4802001 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location15451924-15760157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15452792 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 238 (M238K)
Ref Sequence ENSEMBL: ENSMUSP00000049975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053017] [ENSMUST00000130553]
Predicted Effect probably benign
Transcript: ENSMUST00000053017
AA Change: M238K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000049975
Gene: ENSMUSG00000047161
AA Change: M238K

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
Pfam:Sulfotransfer_2 174 409 1.9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130553
SMART Domains Protein: ENSMUSP00000121484
Gene: ENSMUSG00000047161

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.0%
  • 10x: 85.4%
  • 20x: 73.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sulfotransferase 2 family. It is localized to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of non-reducing N-acetylgalactosamine (GalNAc) residues in both N-glycans and O-glycans. Sulfate groups on carbohydrates confer highly specific functions to glycoproteins, glycolipids, and proteoglycans, and are critical for cell-cell interaction, signal transduction, and embryonic development. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,346 D741E probably benign Het
Abca16 A G 7: 120,540,128 D1461G probably benign Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
Akap5 T C 12: 76,329,932 Y713H probably damaging Het
AW554918 A G 18: 25,340,075 E312G possibly damaging Het
Car4 G A 11: 84,964,405 A157T probably damaging Het
Ctbp2 G A 7: 132,988,245 H397Y possibly damaging Het
Cyp3a59 A G 5: 146,102,801 M295V probably benign Het
Daglb T C 5: 143,503,048 Y586H probably benign Het
Ehbp1l1 G T 19: 5,719,575 P567T possibly damaging Het
Emilin2 A G 17: 71,273,469 I754T probably damaging Het
Esyt2 G A 12: 116,365,837 A672T probably benign Het
Evx1 G T 6: 52,314,190 E116* probably null Het
Exph5 T C 9: 53,374,978 S1120P probably damaging Het
Fam184a A T 10: 53,684,354 L515* probably null Het
Flt4 T A 11: 49,633,169 D525E probably benign Het
Galt T C 4: 41,756,764 W135R probably damaging Het
Ifitm6 A T 7: 141,016,735 C42S probably damaging Het
Ift172 A G 5: 31,285,266 S186P probably benign Het
Kcnk3 A G 5: 30,622,368 E254G probably damaging Het
Kmt2b A G 7: 30,579,571 S1509P probably damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lrba T A 3: 86,664,494 Y2368* probably null Het
Mtmr4 T A 11: 87,611,127 V669E probably benign Het
Myh10 C T 11: 68,765,092 R471C probably damaging Het
Nav1 G A 1: 135,452,933 T1416I unknown Het
Nrip1 A C 16: 76,293,269 S467A probably damaging Het
Ntrk1 T A 3: 87,788,634 N190Y probably damaging Het
Olfr193 A C 16: 59,110,601 M3R probably benign Het
Olfr294 A T 7: 86,616,555 L30Q probably null Het
Pdxp A G 15: 78,918,411 S282G probably damaging Het
Phtf2 A T 5: 20,801,906 S220T probably damaging Het
Piezo2 A T 18: 63,024,469 V2390E probably damaging Het
Pop1 T G 15: 34,529,083 L783R probably benign Het
Prf1 G A 10: 61,300,193 A83T probably benign Het
Rab4b A G 7: 27,175,842 V50A probably benign Het
Rtn1 T A 12: 72,304,326 T370S probably benign Het
Sdr16c5 T A 4: 4,012,423 I123F probably damaging Het
Smg6 T A 11: 75,156,165 V1228D probably damaging Het
Smim19 A G 8: 22,473,523 V23A probably benign Het
Sox13 A T 1: 133,386,258 I346N probably damaging Het
Tap1 T A 17: 34,193,191 Y457N probably damaging Het
Tbck C T 3: 132,752,666 P686S probably damaging Het
Tcof1 A G 18: 60,831,938 S570P unknown Het
Tmc5 A T 7: 118,672,226 M921L probably benign Het
Ttc6 A G 12: 57,725,676 Y1594C possibly damaging Het
Virma T A 4: 11,546,008 H1615Q probably damaging Het
Vmn1r19 T A 6: 57,405,052 Y197N probably damaging Het
Vps13c T C 9: 67,937,786 F2051L probably damaging Het
Wdr6 C T 9: 108,574,566 C706Y probably damaging Het
Zfand4 A G 6: 116,284,775 N100D probably damaging Het
Other mutations in Chst9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Chst9 APN 18 15453030 missense probably benign 0.34
IGL01910:Chst9 APN 18 15452874 missense possibly damaging 0.90
IGL03038:Chst9 APN 18 15495303 missense probably benign
IGL03146:Chst9 APN 18 15452978 missense probably damaging 1.00
R0536:Chst9 UTSW 18 15495330 splice site probably benign
R0647:Chst9 UTSW 18 15452669 missense probably damaging 1.00
R1240:Chst9 UTSW 18 15453174 missense probably benign
R1580:Chst9 UTSW 18 15453065 missense probably benign 0.02
R1892:Chst9 UTSW 18 15452960 missense probably damaging 1.00
R2420:Chst9 UTSW 18 15452284 missense probably damaging 1.00
R2446:Chst9 UTSW 18 15452838 missense possibly damaging 0.90
R4737:Chst9 UTSW 18 15452777 missense probably damaging 1.00
R4790:Chst9 UTSW 18 15453050 missense probably damaging 1.00
R4956:Chst9 UTSW 18 15717988 missense probably damaging 1.00
R5202:Chst9 UTSW 18 15453239 missense probably benign 0.02
R5402:Chst9 UTSW 18 15452815 missense probably damaging 0.98
R5754:Chst9 UTSW 18 15453197 missense possibly damaging 0.77
R6035:Chst9 UTSW 18 15452853 missense probably benign 0.13
R6035:Chst9 UTSW 18 15452853 missense probably benign 0.13
R7225:Chst9 UTSW 18 15452661 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATTCCTACTGGACGGTGAG -3'
(R):5'- GACAAACACAAAATCCTGTACTGTG -3'

Sequencing Primer
(F):5'- TCCAGCAAATAGTAGGCGAATTC -3'
(R):5'- CCTGTACTGTGAAGTACCAAAAGCTG -3'
Posted On2019-06-07