Incidental Mutation 'PIT4812001:Mia2'
ID556926
Institutional Source Beutler Lab
Gene Symbol Mia2
Ensembl Gene ENSMUSG00000021000
Gene Namemelanoma inhibitory activity 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #PIT4812001 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location59095799-59191583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59101579 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 75 (D75V)
Ref Sequence ENSEMBL: ENSMUSP00000021384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021384] [ENSMUST00000219140]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021384
AA Change: D75V

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021384
Gene: ENSMUSG00000021000
AA Change: D75V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SH3 42 100 4.03e-2 SMART
low complexity region 288 297 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219140
AA Change: D75V

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in endoplasmic reticulum-to-Golgi trafficking and regulation of cholesterol metabolism. Three major classes of transcripts are generated from this gene- melanoma inhibitory activity 2-specific transcripts, cTAGE family member 5-specific transcripts and transcripts that include exons from both these transcript species. Additionally, alternative splicing in these transcripts results in multiple transcript variants encoding diverse isoforms. A mutation in this gene (couch-potato or cpto) may result in low levels of plasma cholesterol and triglycerides. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit decreased serum levels of cholesterol, HDL cholesterol, triglyceride, and VLDL triglyceride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Mia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Mia2 APN 12 59160273 splice site probably benign
IGL00791:Mia2 APN 12 59108299 missense possibly damaging 0.82
IGL00821:Mia2 APN 12 59170320 critical splice donor site probably null
IGL00901:Mia2 APN 12 59108029 missense probably damaging 1.00
IGL00985:Mia2 APN 12 59188360 missense probably damaging 1.00
IGL01304:Mia2 APN 12 59104538 missense probably damaging 1.00
IGL01909:Mia2 APN 12 59107945 missense possibly damaging 0.94
IGL02646:Mia2 APN 12 59108836 missense probably damaging 1.00
IGL02800:Mia2 APN 12 59188491 nonsense probably null
IGL03332:Mia2 APN 12 59108398 missense probably damaging 0.97
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0449:Mia2 UTSW 12 59172594 critical splice donor site probably null
R0620:Mia2 UTSW 12 59154419 missense possibly damaging 0.96
R0622:Mia2 UTSW 12 59131578 missense probably damaging 0.98
R0632:Mia2 UTSW 12 59136143 missense probably damaging 0.99
R1643:Mia2 UTSW 12 59179845 splice site probably null
R1654:Mia2 UTSW 12 59108833 missense possibly damaging 0.92
R1706:Mia2 UTSW 12 59144766 nonsense probably null
R1776:Mia2 UTSW 12 59149575 splice site probably benign
R1848:Mia2 UTSW 12 59170251 splice site probably benign
R2240:Mia2 UTSW 12 59107882 missense probably benign 0.01
R2698:Mia2 UTSW 12 59170994 critical splice donor site probably null
R2860:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2861:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2862:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R3429:Mia2 UTSW 12 59189641 missense possibly damaging 0.89
R3861:Mia2 UTSW 12 59109021 missense probably benign 0.00
R3965:Mia2 UTSW 12 59176372 missense probably damaging 1.00
R5156:Mia2 UTSW 12 59172537 missense possibly damaging 0.94
R5249:Mia2 UTSW 12 59108125 missense probably damaging 0.99
R5330:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5331:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5815:Mia2 UTSW 12 59174106 missense possibly damaging 0.95
R5972:Mia2 UTSW 12 59146937 missense probably damaging 1.00
R6651:Mia2 UTSW 12 59154362 missense possibly damaging 0.78
R6676:Mia2 UTSW 12 59108370 missense probably damaging 0.97
R6695:Mia2 UTSW 12 59172580 missense probably damaging 0.99
R6800:Mia2 UTSW 12 59188546 critical splice donor site probably null
R6845:Mia2 UTSW 12 59184278 nonsense probably null
R6919:Mia2 UTSW 12 59129895 missense possibly damaging 0.74
R7058:Mia2 UTSW 12 59184235 missense possibly damaging 0.77
R7209:Mia2 UTSW 12 59154390 missense possibly damaging 0.55
R7274:Mia2 UTSW 12 59108119 missense probably damaging 0.99
R7291:Mia2 UTSW 12 59158369 critical splice donor site probably null
X0063:Mia2 UTSW 12 59136139 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTATCAATAAGTAAACGAGAAGCAG -3'
(R):5'- TCTATAGAAATTGTCGAGCAATCAC -3'

Sequencing Primer
(F):5'- GCAGTGACATTTTAAAGTGTGAGC -3'
(R):5'- TAACGTGCTATGTAGATCAGGC -3'
Posted On2019-06-07