Incidental Mutation 'PIT4791001:Nrxn1'
ID556991
Institutional Source Beutler Lab
Gene Symbol Nrxn1
Ensembl Gene ENSMUSG00000024109
Gene Nameneurexin I
Synonymsneurexin I beta, alpha-latrotoxin receptor (calcium-dependent), A230068P09Rik, neurexin I alpha, neurexin I alpha, neurexin I beta, 1700062G21Rik, 9330127H16Rik, neurexin I alpha, neurexin I beta
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4791001 (G1)
Quality Score171.009
Status Not validated
Chromosome17
Chromosomal Location90033631-91093071 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 90455503 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000054059] [ENSMUST00000072671] [ENSMUST00000159778] [ENSMUST00000160800] [ENSMUST00000160844] [ENSMUST00000161402] [ENSMUST00000172466] [ENSMUST00000174331] [ENSMUST00000174337] [ENSMUST00000176118]
Predicted Effect probably benign
Transcript: ENSMUST00000054059
SMART Domains Protein: ENSMUSP00000057294
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 438 2.3e-36 SMART
LamG 492 644 2.74e-43 SMART
EGF 671 705 1.58e-3 SMART
LamG 730 869 7.27e-25 SMART
LamG 917 1053 8.46e-35 SMART
EGF 1078 1112 1.87e1 SMART
LamG 1140 1297 7.74e-20 SMART
low complexity region 1324 1355 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
4.1m 1444 1462 1.19e-6 SMART
low complexity region 1481 1493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072671
SMART Domains Protein: ENSMUSP00000072458
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 438 2.3e-36 SMART
LamG 492 644 2.74e-43 SMART
EGF 671 705 1.58e-3 SMART
LamG 730 869 7.27e-25 SMART
LamG 917 1053 8.46e-35 SMART
EGF 1078 1112 1.87e1 SMART
LamG 1140 1297 7.74e-20 SMART
low complexity region 1324 1355 N/A INTRINSIC
low complexity region 1423 1438 N/A INTRINSIC
4.1m 1441 1459 1.19e-6 SMART
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159778
SMART Domains Protein: ENSMUSP00000125561
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 284 418 2.3e-36 SMART
LamG 472 624 2.74e-43 SMART
EGF 651 685 1.58e-3 SMART
LamG 710 849 7.27e-25 SMART
LamG 897 1033 8.46e-35 SMART
EGF 1058 1092 1.87e1 SMART
LamG 1120 1277 7.74e-20 SMART
low complexity region 1304 1335 N/A INTRINSIC
low complexity region 1403 1418 N/A INTRINSIC
4.1m 1421 1439 1.19e-6 SMART
low complexity region 1458 1470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160800
SMART Domains Protein: ENSMUSP00000124561
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 300 434 2.3e-36 SMART
LamG 488 640 2.74e-43 SMART
EGF 667 701 1.58e-3 SMART
LamG 726 865 7.27e-25 SMART
LamG 913 1049 8.46e-35 SMART
EGF 1074 1108 1.87e1 SMART
LamG 1136 1293 7.74e-20 SMART
low complexity region 1320 1351 N/A INTRINSIC
low complexity region 1422 1437 N/A INTRINSIC
4.1m 1440 1458 1.19e-6 SMART
low complexity region 1477 1489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160844
SMART Domains Protein: ENSMUSP00000125407
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 446 1.24e-32 SMART
LamG 500 652 2.74e-43 SMART
EGF 679 713 1.58e-3 SMART
LamG 738 877 7.27e-25 SMART
LamG 925 1061 8.46e-35 SMART
EGF 1086 1120 1.87e1 SMART
LamG 1148 1305 7.74e-20 SMART
low complexity region 1332 1363 N/A INTRINSIC
low complexity region 1434 1449 N/A INTRINSIC
4.1m 1452 1470 1.19e-6 SMART
low complexity region 1489 1501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161402
SMART Domains Protein: ENSMUSP00000124116
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 453 3.46e-31 SMART
LamG 507 659 2.74e-43 SMART
EGF 686 720 1.58e-3 SMART
LamG 745 884 7.27e-25 SMART
LamG 932 1068 8.46e-35 SMART
EGF 1093 1127 1.87e1 SMART
LamG 1155 1312 7.74e-20 SMART
low complexity region 1339 1370 N/A INTRINSIC
low complexity region 1441 1456 N/A INTRINSIC
4.1m 1459 1477 1.19e-6 SMART
low complexity region 1496 1508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172466
SMART Domains Protein: ENSMUSP00000134402
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
LamG 109 266 7.74e-20 SMART
low complexity region 293 324 N/A INTRINSIC
low complexity region 395 410 N/A INTRINSIC
4.1m 413 431 1.19e-6 SMART
low complexity region 450 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174331
SMART Domains Protein: ENSMUSP00000133491
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 446 1.24e-32 SMART
LamG 500 652 2.74e-43 SMART
EGF 679 713 1.58e-3 SMART
LamG 738 877 7.27e-25 SMART
LamG 925 1061 8.46e-35 SMART
EGF 1086 1120 1.87e1 SMART
LamG 1148 1275 3.29e-23 SMART
low complexity region 1302 1333 N/A INTRINSIC
low complexity region 1404 1419 N/A INTRINSIC
4.1m 1422 1440 1.19e-6 SMART
low complexity region 1459 1471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174337
SMART Domains Protein: ENSMUSP00000133724
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
LamG 109 236 3.29e-23 SMART
low complexity region 263 294 N/A INTRINSIC
low complexity region 365 380 N/A INTRINSIC
4.1m 383 401 1.19e-6 SMART
low complexity region 420 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176118
SMART Domains Protein: ENSMUSP00000135241
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
Pfam:Laminin_G_2 1 95 3.1e-18 PFAM
Pfam:Laminin_G_1 1 98 3.7e-12 PFAM
EGF 129 163 1.87e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196559
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 83.3%
  • 20x: 68.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a single-pass type I membrane protein that belongs to the neurexin family. Neurexins are synaptic transmembrane receptors that bind endogenous ligands that include neuroligins, dystroglycan, and neurexophilins. Neurexin complexes are required for efficient neurotransmission and are involved in synaptogenesis. In vertebrates, alternate promoter usage results in multiple isoform classes, of which the alpha and beta classes are the best characterized. In humans, allelic variants in this gene are associated with Pitt-Hopkins-like syndrome-2, while deletions have been associated with autism and schizophrenia. Mouse knockouts display decreased spontaneous and evoked vesicle release resulting in impaired synaptic transmission. In addition, knockout mice show altered social approach, reduced social investigation, reduced locomotor activity, and in males, increased aggression. Alternative splicing and promoter usage result in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced Ca(2+)-dependent binding of alpha-latrotoxin to brain membranes. Isolated synaptosomes display only a small reduction in alpha-latrotoxin -triggered glutamate release in the absence of Ca(2+) but show a major decrease in the presence of Ca(2+). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,274,062 F326S possibly damaging Het
Ago2 G A 15: 73,121,240 T472I possibly damaging Het
Ambp T A 4: 63,154,061 probably benign Het
As3mt T A 19: 46,720,349 F261I probably damaging Het
Atxn1l A G 8: 109,731,947 L561P probably damaging Het
Cnr2 A G 4: 135,916,952 T114A probably damaging Het
Dchs1 A G 7: 105,758,971 Y1885H probably damaging Het
Dcn A G 10: 97,507,742 N188S probably benign Het
Dennd6b A C 15: 89,186,752 probably null Het
Dstyk A G 1: 132,449,927 T424A probably benign Het
Gabrr3 A G 16: 59,429,935 probably null Het
Gnai3 A G 3: 108,118,305 S153P probably benign Het
Igkv2-112 T A 6: 68,220,615 S90R probably damaging Het
Lxn T C 3: 67,458,646 D173G probably damaging Het
Mcm3ap T A 10: 76,506,473 I1600N probably damaging Het
Myof A T 19: 37,982,958 probably null Het
Oaz3 A G 3: 94,433,545 Y232H unknown Het
Olfr1107 A T 2: 87,071,702 M144K possibly damaging Het
Pkdcc C T 17: 83,220,148 R252* probably null Het
Plcl1 A G 1: 55,701,931 N907S probably benign Het
Plscr1 T A 9: 92,263,097 Y53* probably null Het
Pm20d2 T C 4: 33,174,756 T377A probably benign Het
Ptchd3 T A 11: 121,832,049 V321D probably damaging Het
Ranbp3l T C 15: 9,060,748 I366T probably damaging Het
Sardh T C 2: 27,197,648 E737G probably damaging Het
Scn1a T C 2: 66,273,282 E1878G probably benign Het
Slit3 T C 11: 35,661,245 V872A possibly damaging Het
Sugp2 C T 8: 70,260,545 Q1054* probably null Het
Syne3 T C 12: 104,963,179 T261A probably benign Het
Tgif2 T C 2: 156,853,312 S126P probably benign Het
Ticrr T C 7: 79,669,638 V457A possibly damaging Het
Tm7sf2 T C 19: 6,063,605 I299V probably benign Het
Tnks1bp1 A G 2: 85,062,558 E943G probably benign Het
Tpd52l2 T A 2: 181,499,888 F21L probably benign Het
Tpm2 A G 4: 43,519,263 L176P probably benign Het
Trim34a C A 7: 104,260,484 T293K probably benign Het
Ttc23 A T 7: 67,662,387 D14V probably damaging Het
Twsg1 T C 17: 65,929,711 E108G probably benign Het
Txndc15 C T 13: 55,721,694 A220V probably benign Het
Vmn1r183 A G 7: 24,054,841 Q23R probably damaging Het
Vmn1r31 A G 6: 58,472,043 V279A probably damaging Het
Vmo1 A C 11: 70,513,835 C113W probably damaging Het
Zfp984 A G 4: 147,756,146 S83P probably benign Het
Zik1 A C 7: 10,492,329 L37R probably benign Het
Other mutations in Nrxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Nrxn1 APN 17 90059474 critical splice donor site probably null
IGL01644:Nrxn1 APN 17 90620873 missense possibly damaging 0.94
IGL01820:Nrxn1 APN 17 90643103 missense probably damaging 0.98
IGL01902:Nrxn1 APN 17 91088491 unclassified probably null
IGL02079:Nrxn1 APN 17 90643083 missense probably damaging 0.99
IGL02089:Nrxn1 APN 17 91088401 missense probably benign 0.01
IGL02133:Nrxn1 APN 17 90643243 missense probably damaging 1.00
IGL02179:Nrxn1 APN 17 90630083 missense probably damaging 0.99
IGL02199:Nrxn1 APN 17 90037258 missense probably damaging 1.00
IGL02262:Nrxn1 APN 17 90704208 missense probably damaging 1.00
IGL02941:Nrxn1 APN 17 90208383 missense probably damaging 1.00
PIT4449001:Nrxn1 UTSW 17 90597579 missense probably damaging 1.00
R0123:Nrxn1 UTSW 17 90995487 splice site probably null
R0212:Nrxn1 UTSW 17 90362758 unclassified probably benign
R0277:Nrxn1 UTSW 17 90700742 critical splice donor site probably null
R0323:Nrxn1 UTSW 17 90700742 critical splice donor site probably null
R0384:Nrxn1 UTSW 17 90208347 missense probably damaging 1.00
R0395:Nrxn1 UTSW 17 91088314 missense possibly damaging 0.90
R0606:Nrxn1 UTSW 17 90565373 missense probably damaging 1.00
R0616:Nrxn1 UTSW 17 90362857 missense probably damaging 1.00
R0624:Nrxn1 UTSW 17 91088689 missense unknown
R0633:Nrxn1 UTSW 17 90704181 missense probably damaging 1.00
R0927:Nrxn1 UTSW 17 90037330 missense probably damaging 1.00
R1035:Nrxn1 UTSW 17 90163874 missense probably damaging 0.96
R1221:Nrxn1 UTSW 17 90643294 missense probably damaging 0.97
R1403:Nrxn1 UTSW 17 90643053 missense probably benign 0.11
R1403:Nrxn1 UTSW 17 90643053 missense probably benign 0.11
R1691:Nrxn1 UTSW 17 90162289 missense probably damaging 0.98
R1703:Nrxn1 UTSW 17 90208417 missense probably damaging 1.00
R1709:Nrxn1 UTSW 17 90037187 missense probably damaging 1.00
R1721:Nrxn1 UTSW 17 90162404 missense probably damaging 1.00
R1792:Nrxn1 UTSW 17 90588824 missense probably damaging 0.96
R1980:Nrxn1 UTSW 17 91088318 missense probably benign 0.01
R2116:Nrxn1 UTSW 17 90704277 missense probably damaging 1.00
R2117:Nrxn1 UTSW 17 90704277 missense probably damaging 1.00
R2162:Nrxn1 UTSW 17 90162431 missense probably damaging 1.00
R3119:Nrxn1 UTSW 17 90597519 nonsense probably null
R3409:Nrxn1 UTSW 17 90208367 missense probably damaging 1.00
R3683:Nrxn1 UTSW 17 90623452 missense probably damaging 1.00
R3885:Nrxn1 UTSW 17 90623471 missense probably damaging 1.00
R3939:Nrxn1 UTSW 17 90208421 missense probably damaging 1.00
R4475:Nrxn1 UTSW 17 90701982 missense probably damaging 0.98
R4640:Nrxn1 UTSW 17 90560768 missense probably damaging 1.00
R4678:Nrxn1 UTSW 17 90623422 missense probably damaging 1.00
R4690:Nrxn1 UTSW 17 90037081 missense probably damaging 1.00
R4790:Nrxn1 UTSW 17 90455049 missense possibly damaging 0.86
R4877:Nrxn1 UTSW 17 91088177 missense probably benign 0.33
R4989:Nrxn1 UTSW 17 90620846 intron probably benign
R5204:Nrxn1 UTSW 17 90162364 missense probably damaging 1.00
R5205:Nrxn1 UTSW 17 90163874 missense probably damaging 0.96
R5239:Nrxn1 UTSW 17 90704109 missense probably damaging 1.00
R5250:Nrxn1 UTSW 17 90535441 intron probably benign
R5473:Nrxn1 UTSW 17 90590092 missense probably damaging 1.00
R5629:Nrxn1 UTSW 17 90590032 missense possibly damaging 0.75
R5743:Nrxn1 UTSW 17 90643224 missense probably damaging 1.00
R5910:Nrxn1 UTSW 17 90704318 nonsense probably null
R5961:Nrxn1 UTSW 17 90454943 missense probably damaging 0.99
R5979:Nrxn1 UTSW 17 91088203 missense possibly damaging 0.54
R5992:Nrxn1 UTSW 17 90623507 missense probably benign 0.01
R6024:Nrxn1 UTSW 17 90590098 missense possibly damaging 0.88
R6031:Nrxn1 UTSW 17 90588790 missense probably damaging 1.00
R6031:Nrxn1 UTSW 17 90588790 missense probably damaging 1.00
R6185:Nrxn1 UTSW 17 90037136 missense probably damaging 1.00
R6220:Nrxn1 UTSW 17 91088476 missense probably benign 0.14
R6306:Nrxn1 UTSW 17 90565446 missense possibly damaging 0.55
R6621:Nrxn1 UTSW 17 90162182 missense probably damaging 1.00
R6669:Nrxn1 UTSW 17 90059563 missense probably damaging 0.98
R6770:Nrxn1 UTSW 17 90037179 missense probably damaging 1.00
R6798:Nrxn1 UTSW 17 90629950 missense probably damaging 1.00
R6923:Nrxn1 UTSW 17 91088233 missense probably benign 0.06
R7140:Nrxn1 UTSW 17 91088764 start gained probably benign
R7374:Nrxn1 UTSW 17 90588669 critical splice donor site probably null
R7564:Nrxn1 UTSW 17 90362906 missense not run
R7570:Nrxn1 UTSW 17 90162379 missense not run
X0021:Nrxn1 UTSW 17 90590212 missense probably damaging 1.00
X0063:Nrxn1 UTSW 17 90362831 missense possibly damaging 0.54
Z1088:Nrxn1 UTSW 17 90059505 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTGTCCGGAAAAGCAGAC -3'
(R):5'- ATCCCTGCTGTCTTCACGAG -3'

Sequencing Primer
(F):5'- TCCGGAAAAGCAGACCCGAAG -3'
(R):5'- ACTCGGAGATTGCCTCTGGAG -3'
Posted On2019-06-07