Incidental Mutation 'PIT4151001:Dnmt3b'
ID557005
Institutional Source Beutler Lab
Gene Symbol Dnmt3b
Ensembl Gene ENSMUSG00000027478
Gene NameDNA methyltransferase 3B
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4151001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location153649450-153687730 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 153684479 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056495] [ENSMUST00000072997] [ENSMUST00000081628] [ENSMUST00000088976] [ENSMUST00000103150] [ENSMUST00000103151] [ENSMUST00000109771] [ENSMUST00000109772] [ENSMUST00000109773] [ENSMUST00000109774]
Predicted Effect probably null
Transcript: ENSMUST00000056495
SMART Domains Protein: ENSMUSP00000051830
Gene: ENSMUSG00000027478

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 582 732 3.1e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000072997
SMART Domains Protein: ENSMUSP00000072761
Gene: ENSMUSG00000027478

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 581 731 4.5e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000081628
SMART Domains Protein: ENSMUSP00000080334
Gene: ENSMUSG00000027478

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 1e-54 PDB
Blast:RING 463 512 7e-28 BLAST
Pfam:DNA_methylase 561 711 4.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088976
SMART Domains Protein: ENSMUSP00000086370
Gene: ENSMUSG00000027478

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 7e-55 PDB
Blast:RING 483 532 5e-28 BLAST
Pfam:DNA_methylase 581 727 2.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103150
SMART Domains Protein: ENSMUSP00000099439
Gene: ENSMUSG00000027478

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 8e-55 PDB
Blast:RING 463 512 6e-28 BLAST
Pfam:DNA_methylase 561 707 4.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103151
SMART Domains Protein: ENSMUSP00000099440
Gene: ENSMUSG00000027478

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 8e-55 PDB
Blast:RING 463 512 6e-28 BLAST
Pfam:DNA_methylase 561 707 4.2e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109771
SMART Domains Protein: ENSMUSP00000105393
Gene: ENSMUSG00000027478

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 582 732 3.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109772
SMART Domains Protein: ENSMUSP00000105394
Gene: ENSMUSG00000027478

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 7e-55 PDB
Blast:RING 483 532 5e-28 BLAST
Pfam:DNA_methylase 581 727 2.9e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109773
SMART Domains Protein: ENSMUSP00000105395
Gene: ENSMUSG00000027478

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 1e-54 PDB
Blast:RING 463 512 7e-28 BLAST
Pfam:DNA_methylase 561 711 4.4e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109774
SMART Domains Protein: ENSMUSP00000105396
Gene: ENSMUSG00000027478

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 581 731 4.5e-15 PFAM
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.4%
  • 10x: 84.6%
  • 20x: 72.1%
Validation Efficiency
MGI Phenotype FUNCTION: This is one of two related genes encoding de novo DNA methyltransferases, which are responsible for the establishment of DNA methylation patterns in embryos. Loss of function of this gene results in severe developmental defects and loss of viability. Mutation of the related gene in humans causes immunodeficiency-centromeric instability-facial anomalies (ICF) syndrome. There is a pseudogene for this gene located adjacent to this gene in the same region of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit growth retardation and rostral neural tube defects, and die prenatally. Mutants exhibit slight under-methylation of endogenous viral DNA and substantial demethylation of minor satellite DNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,137,021 L1389P probably damaging Het
Acot10 C T 15: 20,666,598 G19D probably damaging Het
Adam20 G A 8: 40,795,044 V64I possibly damaging Het
Ak6 T A 13: 100,655,095 D15E probably damaging Het
Atp1a2 A G 1: 172,290,721 Y129H probably damaging Het
Caskin1 C T 17: 24,502,219 T511I probably damaging Het
Casp9 C T 4: 141,793,948 R32* probably null Het
Ccdc40 A G 11: 119,242,451 E445G probably damaging Het
Cct8 T C 16: 87,487,657 E273G probably damaging Het
Chd5 G A 4: 152,378,529 V1380I probably damaging Het
Coro2b C T 9: 62,429,004 G272D probably damaging Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dgki A T 6: 37,063,981 H298Q probably benign Het
Dzip1 A G 14: 118,922,788 F3L probably damaging Het
Egf A G 3: 129,702,549 S807P probably benign Het
Emc10 C T 7: 44,493,203 R105H Het
Enthd1 T C 15: 80,452,736 E499G probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Fer1l5 T A 1: 36,411,647 M1242K probably benign Het
Gm13083 T A 4: 143,616,152 C276* probably null Het
Gm3415 A G 5: 146,556,269 R36G probably benign Het
Gm5797 C A 14: 7,330,318 M114I possibly damaging Het
Gmppa A T 1: 75,441,824 R284* probably null Het
Homer1 G C 13: 93,349,216 K118N probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kcnc4 G A 3: 107,458,703 A63V probably damaging Het
Kif11 T A 19: 37,384,597 I88N probably damaging Het
Krba1 T C 6: 48,402,897 F9S probably damaging Het
Nckap1 A G 2: 80,520,370 probably null Het
Nox4 A T 7: 87,304,889 Y134F probably benign Het
Olfr1026 T A 2: 85,924,042 M258K probably damaging Het
Olfr1031 T C 2: 85,992,194 C126R probably damaging Het
Olfr1054 G T 2: 86,332,829 H176N possibly damaging Het
Olfr1252 T A 2: 89,721,893 T73S probably benign Het
Olfr562-ps1 T C 7: 102,782,258 S261P probably benign Het
Olfr672 A G 7: 104,996,217 L229P probably damaging Het
Pcdh17 G T 14: 84,447,358 V422L probably benign Het
Pcx T A 19: 4,603,129 V275E probably damaging Het
Pde6h A T 6: 136,961,187 M53L possibly damaging Het
Phactr3 A T 2: 178,334,068 E535D probably damaging Het
Pkn3 C A 2: 30,090,527 T810N probably damaging Het
Pnpla5 T C 15: 84,118,626 E252G probably damaging Het
Psg17 A G 7: 18,814,605 S414P probably benign Het
Pzp T A 6: 128,525,296 Q30L probably benign Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Ret T C 6: 118,164,741 D975G probably benign Het
Sarnp A G 10: 128,877,366 I209V probably benign Het
Sorl1 A T 9: 41,968,622 V2210D probably damaging Het
Stard9 C T 2: 120,702,756 Q3165* probably null Het
Tmem64 A T 4: 15,283,159 I319F probably damaging Het
Vmn1r176 A T 7: 23,835,383 V115D probably damaging Het
Vmn1r2 A G 4: 3,172,623 T181A probably benign Het
Vmn2r2 T C 3: 64,116,913 E749G possibly damaging Het
Vps35 G A 8: 85,284,048 T222I possibly damaging Het
Zfp532 A G 18: 65,624,414 T473A probably damaging Het
Zfyve16 A G 13: 92,521,204 V733A probably damaging Het
Zranb1 T A 7: 132,949,994 S125T probably benign Het
Other mutations in Dnmt3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Dnmt3b APN 2 153672502 missense possibly damaging 0.88
IGL00931:Dnmt3b APN 2 153686250 splice site probably benign
IGL01073:Dnmt3b APN 2 153670842 splice site probably benign
IGL01138:Dnmt3b APN 2 153661441 missense probably benign 0.01
IGL01960:Dnmt3b APN 2 153676711 missense possibly damaging 0.83
IGL02884:Dnmt3b APN 2 153674377 missense probably damaging 1.00
IGL03382:Dnmt3b APN 2 153686359 missense probably damaging 1.00
R0062:Dnmt3b UTSW 2 153672272 missense probably benign 0.01
R0122:Dnmt3b UTSW 2 153676698 missense probably damaging 1.00
R0147:Dnmt3b UTSW 2 153661457 missense possibly damaging 0.68
R0178:Dnmt3b UTSW 2 153675018 missense probably benign 0.41
R0751:Dnmt3b UTSW 2 153674842 intron probably null
R1696:Dnmt3b UTSW 2 153676710 nonsense probably null
R1795:Dnmt3b UTSW 2 153683639 missense possibly damaging 0.92
R1889:Dnmt3b UTSW 2 153676759 missense probably benign
R2898:Dnmt3b UTSW 2 153667630 missense possibly damaging 0.85
R4201:Dnmt3b UTSW 2 153670417 nonsense probably null
R4630:Dnmt3b UTSW 2 153670315 nonsense probably null
R4870:Dnmt3b UTSW 2 153670364 missense probably benign 0.01
R5648:Dnmt3b UTSW 2 153677198 missense probably damaging 1.00
R5814:Dnmt3b UTSW 2 153672497 missense probably benign 0.00
R6311:Dnmt3b UTSW 2 153674005 missense probably damaging 1.00
R6625:Dnmt3b UTSW 2 153665313 missense probably benign
R6818:Dnmt3b UTSW 2 153686284 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGACACATAAAGAATCCCTTCC -3'
(R):5'- TGCAACTGAGAGATGACTGC -3'

Sequencing Primer
(F):5'- ATAAAGAATCCCTTCCAGTCTGTC -3'
(R):5'- CAACTGAGAGATGACTGCTTCTG -3'
Posted On2019-06-07