Incidental Mutation 'PIT4151001:Vmn2r2'
ID557007
Institutional Source Beutler Lab
Gene Symbol Vmn2r2
Ensembl Gene ENSMUSG00000043897
Gene Namevomeronasal 2, receptor 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #PIT4151001 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location64116432-64140543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64116913 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 749 (E749G)
Ref Sequence ENSEMBL: ENSMUSP00000135110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077958] [ENSMUST00000177151]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077958
AA Change: E665G

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077109
Gene: ENSMUSG00000043897
AA Change: E665G

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 4.5e-80 PFAM
Pfam:NCD3G 458 511 8.3e-18 PFAM
Pfam:7tm_3 542 779 1.3e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177151
AA Change: E749G

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135110
Gene: ENSMUSG00000043897
AA Change: E749G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 83 500 1.6e-84 PFAM
Pfam:NCD3G 542 595 2.6e-17 PFAM
Pfam:7tm_3 628 862 1.9e-47 PFAM
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.4%
  • 10x: 84.6%
  • 20x: 72.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,137,021 L1389P probably damaging Het
Acot10 C T 15: 20,666,598 G19D probably damaging Het
Adam20 G A 8: 40,795,044 V64I possibly damaging Het
Ak6 T A 13: 100,655,095 D15E probably damaging Het
Atp1a2 A G 1: 172,290,721 Y129H probably damaging Het
Caskin1 C T 17: 24,502,219 T511I probably damaging Het
Casp9 C T 4: 141,793,948 R32* probably null Het
Ccdc40 A G 11: 119,242,451 E445G probably damaging Het
Cct8 T C 16: 87,487,657 E273G probably damaging Het
Chd5 G A 4: 152,378,529 V1380I probably damaging Het
Coro2b C T 9: 62,429,004 G272D probably damaging Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dgki A T 6: 37,063,981 H298Q probably benign Het
Dnmt3b T G 2: 153,684,479 probably null Het
Dzip1 A G 14: 118,922,788 F3L probably damaging Het
Egf A G 3: 129,702,549 S807P probably benign Het
Emc10 C T 7: 44,493,203 R105H Het
Enthd1 T C 15: 80,452,736 E499G probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Fer1l5 T A 1: 36,411,647 M1242K probably benign Het
Gm13083 T A 4: 143,616,152 C276* probably null Het
Gm3415 A G 5: 146,556,269 R36G probably benign Het
Gm5797 C A 14: 7,330,318 M114I possibly damaging Het
Gmppa A T 1: 75,441,824 R284* probably null Het
Homer1 G C 13: 93,349,216 K118N probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kcnc4 G A 3: 107,458,703 A63V probably damaging Het
Kif11 T A 19: 37,384,597 I88N probably damaging Het
Krba1 T C 6: 48,402,897 F9S probably damaging Het
Nckap1 A G 2: 80,520,370 probably null Het
Nox4 A T 7: 87,304,889 Y134F probably benign Het
Olfr1026 T A 2: 85,924,042 M258K probably damaging Het
Olfr1031 T C 2: 85,992,194 C126R probably damaging Het
Olfr1054 G T 2: 86,332,829 H176N possibly damaging Het
Olfr1252 T A 2: 89,721,893 T73S probably benign Het
Olfr562-ps1 T C 7: 102,782,258 S261P probably benign Het
Olfr672 A G 7: 104,996,217 L229P probably damaging Het
Pcdh17 G T 14: 84,447,358 V422L probably benign Het
Pcx T A 19: 4,603,129 V275E probably damaging Het
Pde6h A T 6: 136,961,187 M53L possibly damaging Het
Phactr3 A T 2: 178,334,068 E535D probably damaging Het
Pkn3 C A 2: 30,090,527 T810N probably damaging Het
Pnpla5 T C 15: 84,118,626 E252G probably damaging Het
Psg17 A G 7: 18,814,605 S414P probably benign Het
Pzp T A 6: 128,525,296 Q30L probably benign Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Ret T C 6: 118,164,741 D975G probably benign Het
Sarnp A G 10: 128,877,366 I209V probably benign Het
Sorl1 A T 9: 41,968,622 V2210D probably damaging Het
Stard9 C T 2: 120,702,756 Q3165* probably null Het
Tmem64 A T 4: 15,283,159 I319F probably damaging Het
Vmn1r176 A T 7: 23,835,383 V115D probably damaging Het
Vmn1r2 A G 4: 3,172,623 T181A probably benign Het
Vps35 G A 8: 85,284,048 T222I possibly damaging Het
Zfp532 A G 18: 65,624,414 T473A probably damaging Het
Zfyve16 A G 13: 92,521,204 V733A probably damaging Het
Zranb1 T A 7: 132,949,994 S125T probably benign Het
Other mutations in Vmn2r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Vmn2r2 APN 3 64133898 splice site probably benign
IGL00980:Vmn2r2 APN 3 64117180 missense probably benign 0.11
IGL01389:Vmn2r2 APN 3 64117009 missense probably damaging 0.97
IGL01804:Vmn2r2 APN 3 64134256 missense possibly damaging 0.91
IGL02750:Vmn2r2 APN 3 64117402 missense probably damaging 1.00
IGL02829:Vmn2r2 APN 3 64118751 splice site probably benign
IGL03036:Vmn2r2 APN 3 64116900 missense probably benign 0.01
IGL03174:Vmn2r2 APN 3 64117123 nonsense probably null
R0029:Vmn2r2 UTSW 3 64116944 missense probably benign 0.00
R0310:Vmn2r2 UTSW 3 64134618 missense probably damaging 1.00
R0357:Vmn2r2 UTSW 3 64133899 splice site probably null
R0637:Vmn2r2 UTSW 3 64126578 missense probably benign 0.00
R1626:Vmn2r2 UTSW 3 64134500 missense possibly damaging 0.61
R1662:Vmn2r2 UTSW 3 64117130 missense probably benign 0.00
R1710:Vmn2r2 UTSW 3 64117399 missense probably benign 0.19
R1797:Vmn2r2 UTSW 3 64134707 missense probably benign 0.00
R1862:Vmn2r2 UTSW 3 64134521 missense possibly damaging 0.79
R1971:Vmn2r2 UTSW 3 64126700 missense probably damaging 1.00
R2051:Vmn2r2 UTSW 3 64117345 missense possibly damaging 0.77
R2099:Vmn2r2 UTSW 3 64117053 missense probably damaging 1.00
R2275:Vmn2r2 UTSW 3 64116509 missense probably benign 0.00
R3078:Vmn2r2 UTSW 3 64134632 missense probably benign 0.22
R3418:Vmn2r2 UTSW 3 64116899 missense probably benign 0.00
R3419:Vmn2r2 UTSW 3 64116899 missense probably benign 0.00
R3959:Vmn2r2 UTSW 3 64140526 missense probably benign
R4230:Vmn2r2 UTSW 3 64134491 missense probably benign 0.00
R4258:Vmn2r2 UTSW 3 64134697 missense probably damaging 1.00
R4810:Vmn2r2 UTSW 3 64137462 missense probably damaging 1.00
R4822:Vmn2r2 UTSW 3 64134539 missense probably damaging 0.99
R4919:Vmn2r2 UTSW 3 64117157 missense possibly damaging 0.56
R4925:Vmn2r2 UTSW 3 64137471 start codon destroyed probably null 0.03
R4954:Vmn2r2 UTSW 3 64140484 missense probably benign 0.00
R5071:Vmn2r2 UTSW 3 64116900 missense probably benign 0.01
R5315:Vmn2r2 UTSW 3 64116956 missense probably benign 0.37
R5450:Vmn2r2 UTSW 3 64126590 missense probably benign
R5577:Vmn2r2 UTSW 3 64116995 missense probably benign 0.00
R5595:Vmn2r2 UTSW 3 64126615 missense possibly damaging 0.74
R5727:Vmn2r2 UTSW 3 64117187 missense probably benign 0.41
R5810:Vmn2r2 UTSW 3 64117394 missense probably damaging 1.00
R5919:Vmn2r2 UTSW 3 64137302 missense probably benign 0.39
R6052:Vmn2r2 UTSW 3 64117361 missense possibly damaging 0.56
R6084:Vmn2r2 UTSW 3 64117046 missense probably benign 0.01
R6299:Vmn2r2 UTSW 3 64116653 nonsense probably null
R6762:Vmn2r2 UTSW 3 64134449 missense probably damaging 1.00
R6858:Vmn2r2 UTSW 3 64137494 missense probably damaging 1.00
R6889:Vmn2r2 UTSW 3 64117267 missense probably damaging 0.99
R6990:Vmn2r2 UTSW 3 64117187 missense probably benign 0.02
R7195:Vmn2r2 UTSW 3 64116479 missense probably benign 0.01
R7269:Vmn2r2 UTSW 3 64126577 missense probably benign 0.32
X0024:Vmn2r2 UTSW 3 64137286 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCTTCATAATAGTTATCTGGCAG -3'
(R):5'- AAGCCATGCAACTGGTCCTG -3'

Sequencing Primer
(F):5'- CATAATAGTTATCTGGCAGCTGGC -3'
(R):5'- TGCAACTGGTCCTGCATGG -3'
Posted On2019-06-07