Incidental Mutation 'PIT4151001:Zranb1'
ID557032
Institutional Source Beutler Lab
Gene Symbol Zranb1
Ensembl Gene ENSMUSG00000030967
Gene Namezinc finger, RAN-binding domain containing 1
Synonyms9330160G10Rik, D7Wsu87e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.870) question?
Stock #PIT4151001 (G1)
Quality Score216.009
Status Not validated
Chromosome7
Chromosomal Location132931142-132986391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132949994 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 125 (S125T)
Ref Sequence ENSEMBL: ENSMUSP00000033265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033265] [ENSMUST00000106157] [ENSMUST00000124096] [ENSMUST00000210507] [ENSMUST00000215716]
Predicted Effect probably benign
Transcript: ENSMUST00000033265
AA Change: S125T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033265
Gene: ENSMUSG00000030967
AA Change: S125T

DomainStartEndE-ValueType
ZnF_RBZ 6 30 9.14e-5 SMART
ZnF_RBZ 86 110 6.56e-6 SMART
ZnF_RBZ 151 175 1.69e-8 SMART
low complexity region 180 195 N/A INTRINSIC
Pfam:OTU 438 586 9.8e-35 PFAM
low complexity region 698 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106157
AA Change: S125T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101763
Gene: ENSMUSG00000030967
AA Change: S125T

DomainStartEndE-ValueType
ZnF_RBZ 6 30 9.14e-5 SMART
ZnF_RBZ 86 110 6.56e-6 SMART
ZnF_RBZ 151 175 1.69e-8 SMART
low complexity region 180 195 N/A INTRINSIC
Pfam:OTU 438 586 1.5e-40 PFAM
low complexity region 698 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210507
AA Change: S125T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000215716
AA Change: S151T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.4%
  • 10x: 84.6%
  • 20x: 72.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased CD4+ T cells and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,137,021 L1389P probably damaging Het
Acot10 C T 15: 20,666,598 G19D probably damaging Het
Adam20 G A 8: 40,795,044 V64I possibly damaging Het
Ak6 T A 13: 100,655,095 D15E probably damaging Het
Atp1a2 A G 1: 172,290,721 Y129H probably damaging Het
Caskin1 C T 17: 24,502,219 T511I probably damaging Het
Casp9 C T 4: 141,793,948 R32* probably null Het
Ccdc40 A G 11: 119,242,451 E445G probably damaging Het
Cct8 T C 16: 87,487,657 E273G probably damaging Het
Chd5 G A 4: 152,378,529 V1380I probably damaging Het
Coro2b C T 9: 62,429,004 G272D probably damaging Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dgki A T 6: 37,063,981 H298Q probably benign Het
Dnmt3b T G 2: 153,684,479 probably null Het
Dzip1 A G 14: 118,922,788 F3L probably damaging Het
Egf A G 3: 129,702,549 S807P probably benign Het
Emc10 C T 7: 44,493,203 R105H Het
Enthd1 T C 15: 80,452,736 E499G probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Fer1l5 T A 1: 36,411,647 M1242K probably benign Het
Gm13083 T A 4: 143,616,152 C276* probably null Het
Gm3415 A G 5: 146,556,269 R36G probably benign Het
Gm5797 C A 14: 7,330,318 M114I possibly damaging Het
Gmppa A T 1: 75,441,824 R284* probably null Het
Homer1 G C 13: 93,349,216 K118N probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kcnc4 G A 3: 107,458,703 A63V probably damaging Het
Kif11 T A 19: 37,384,597 I88N probably damaging Het
Krba1 T C 6: 48,402,897 F9S probably damaging Het
Nckap1 A G 2: 80,520,370 probably null Het
Nox4 A T 7: 87,304,889 Y134F probably benign Het
Olfr1026 T A 2: 85,924,042 M258K probably damaging Het
Olfr1031 T C 2: 85,992,194 C126R probably damaging Het
Olfr1054 G T 2: 86,332,829 H176N possibly damaging Het
Olfr1252 T A 2: 89,721,893 T73S probably benign Het
Olfr562-ps1 T C 7: 102,782,258 S261P probably benign Het
Olfr672 A G 7: 104,996,217 L229P probably damaging Het
Pcdh17 G T 14: 84,447,358 V422L probably benign Het
Pcx T A 19: 4,603,129 V275E probably damaging Het
Pde6h A T 6: 136,961,187 M53L possibly damaging Het
Phactr3 A T 2: 178,334,068 E535D probably damaging Het
Pkn3 C A 2: 30,090,527 T810N probably damaging Het
Pnpla5 T C 15: 84,118,626 E252G probably damaging Het
Psg17 A G 7: 18,814,605 S414P probably benign Het
Pzp T A 6: 128,525,296 Q30L probably benign Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Ret T C 6: 118,164,741 D975G probably benign Het
Sarnp A G 10: 128,877,366 I209V probably benign Het
Sorl1 A T 9: 41,968,622 V2210D probably damaging Het
Stard9 C T 2: 120,702,756 Q3165* probably null Het
Tmem64 A T 4: 15,283,159 I319F probably damaging Het
Vmn1r176 A T 7: 23,835,383 V115D probably damaging Het
Vmn1r2 A G 4: 3,172,623 T181A probably benign Het
Vmn2r2 T C 3: 64,116,913 E749G possibly damaging Het
Vps35 G A 8: 85,284,048 T222I possibly damaging Het
Zfp532 A G 18: 65,624,414 T473A probably damaging Het
Zfyve16 A G 13: 92,521,204 V733A probably damaging Het
Other mutations in Zranb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zranb1 APN 7 132982504 splice site probably benign
IGL00843:Zranb1 APN 7 132949893 missense probably benign 0.26
IGL01727:Zranb1 APN 7 132966620 missense probably damaging 1.00
IGL02087:Zranb1 APN 7 132973417 splice site probably benign
IGL02676:Zranb1 APN 7 132966681 missense probably benign 0.16
IGL03081:Zranb1 APN 7 132950397 missense probably damaging 0.99
IGL03095:Zranb1 APN 7 132949906 nonsense probably null
IGL03186:Zranb1 APN 7 132950203 missense possibly damaging 0.68
R0207:Zranb1 UTSW 7 132950385 missense probably damaging 1.00
R0470:Zranb1 UTSW 7 132982771 missense probably damaging 1.00
R0854:Zranb1 UTSW 7 132949848 missense possibly damaging 0.78
R1318:Zranb1 UTSW 7 132966552 nonsense probably null
R1389:Zranb1 UTSW 7 132971333 missense probably damaging 1.00
R1480:Zranb1 UTSW 7 132950016 missense probably benign 0.39
R1656:Zranb1 UTSW 7 132949767 missense probably benign 0.31
R1956:Zranb1 UTSW 7 132982729 missense probably damaging 1.00
R1958:Zranb1 UTSW 7 132982729 missense probably damaging 1.00
R2010:Zranb1 UTSW 7 132966696 critical splice donor site probably null
R2289:Zranb1 UTSW 7 132950039 missense probably damaging 1.00
R3831:Zranb1 UTSW 7 132982776 missense probably damaging 0.98
R4128:Zranb1 UTSW 7 132966552 nonsense probably null
R4745:Zranb1 UTSW 7 132972714 missense probably damaging 0.97
R5121:Zranb1 UTSW 7 132950187 missense probably benign 0.06
R5262:Zranb1 UTSW 7 132982827 small insertion probably benign
R5263:Zranb1 UTSW 7 132982827 small insertion probably benign
R5264:Zranb1 UTSW 7 132982827 small insertion probably benign
R5522:Zranb1 UTSW 7 132983949 makesense probably null
R6252:Zranb1 UTSW 7 132983904 missense probably benign 0.00
R6519:Zranb1 UTSW 7 132950128 nonsense probably null
R6671:Zranb1 UTSW 7 132971313 missense probably damaging 1.00
R6827:Zranb1 UTSW 7 132949745 missense probably benign 0.17
R6928:Zranb1 UTSW 7 132966594 missense possibly damaging 0.65
R7313:Zranb1 UTSW 7 132982752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATCCTTCCAGTACTGAAGG -3'
(R):5'- TGCCAACTCTATTGCTTCAATG -3'

Sequencing Primer
(F):5'- TCCTTCCAGTACTGAAGGTGGAAG -3'
(R):5'- AATGTTATTAGGTCTGGGATGGTCAC -3'
Posted On2019-06-07