Incidental Mutation 'PIT4151001:Zfp532'
ID557050
Institutional Source Beutler Lab
Gene Symbol Zfp532
Ensembl Gene ENSMUSG00000042439
Gene Namezinc finger protein 532
SynonymsC530030I18Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.346) question?
Stock #PIT4151001 (G1)
Quality Score209.009
Status Not validated
Chromosome18
Chromosomal Location65580230-65689443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65624414 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 473 (T473A)
Ref Sequence ENSEMBL: ENSMUSP00000036582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049016] [ENSMUST00000169679] [ENSMUST00000182140] [ENSMUST00000182319] [ENSMUST00000182478] [ENSMUST00000182655] [ENSMUST00000182684] [ENSMUST00000182852] [ENSMUST00000182973] [ENSMUST00000182979] [ENSMUST00000183236] [ENSMUST00000183319] [ENSMUST00000183326]
Predicted Effect probably damaging
Transcript: ENSMUST00000049016
AA Change: T473A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036582
Gene: ENSMUSG00000042439
AA Change: T473A

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 784 807 1.25e-1 SMART
ZnF_C2H2 814 840 1.43e-1 SMART
low complexity region 860 872 N/A INTRINSIC
ZnF_C2H2 909 931 1.31e0 SMART
ZnF_C2H2 938 961 9.44e-2 SMART
ZnF_C2H2 999 1021 6.88e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169679
AA Change: T473A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129390
Gene: ENSMUSG00000042439
AA Change: T473A

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 784 807 1.25e-1 SMART
ZnF_C2H2 814 840 1.43e-1 SMART
low complexity region 860 872 N/A INTRINSIC
ZnF_C2H2 909 931 1.31e0 SMART
ZnF_C2H2 938 961 9.44e-2 SMART
ZnF_C2H2 999 1021 6.88e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182140
Predicted Effect probably benign
Transcript: ENSMUST00000182319
Predicted Effect probably benign
Transcript: ENSMUST00000182478
AA Change: T473A

PolyPhen 2 Score 0.340 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138315
Gene: ENSMUSG00000042439
AA Change: T473A

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 780 802 4.34e0 SMART
ZnF_C2H2 808 832 1.55e1 SMART
ZnF_C2H2 839 862 8.94e-3 SMART
ZnF_C2H2 867 890 3.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182655
Predicted Effect probably benign
Transcript: ENSMUST00000182684
Predicted Effect possibly damaging
Transcript: ENSMUST00000182852
AA Change: T473A

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138663
Gene: ENSMUSG00000042439
AA Change: T473A

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 780 802 4.34e0 SMART
ZnF_C2H2 808 832 1.55e1 SMART
ZnF_C2H2 839 862 8.94e-3 SMART
ZnF_C2H2 867 890 3.78e-1 SMART
ZnF_C2H2 902 924 7.15e-2 SMART
ZnF_C2H2 933 956 1.43e-1 SMART
ZnF_C2H2 1022 1045 4.72e-2 SMART
ZnF_C2H2 1052 1075 1.25e-1 SMART
ZnF_C2H2 1082 1108 1.43e-1 SMART
low complexity region 1128 1140 N/A INTRINSIC
ZnF_C2H2 1177 1199 1.31e0 SMART
ZnF_C2H2 1206 1229 9.44e-2 SMART
ZnF_C2H2 1267 1289 6.88e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182973
Predicted Effect probably damaging
Transcript: ENSMUST00000182979
AA Change: T473A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138225
Gene: ENSMUSG00000042439
AA Change: T473A

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183236
Predicted Effect probably benign
Transcript: ENSMUST00000183319
Predicted Effect probably benign
Transcript: ENSMUST00000183326
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.4%
  • 10x: 84.6%
  • 20x: 72.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,137,021 L1389P probably damaging Het
Acot10 C T 15: 20,666,598 G19D probably damaging Het
Adam20 G A 8: 40,795,044 V64I possibly damaging Het
Ak6 T A 13: 100,655,095 D15E probably damaging Het
Atp1a2 A G 1: 172,290,721 Y129H probably damaging Het
Caskin1 C T 17: 24,502,219 T511I probably damaging Het
Casp9 C T 4: 141,793,948 R32* probably null Het
Ccdc40 A G 11: 119,242,451 E445G probably damaging Het
Cct8 T C 16: 87,487,657 E273G probably damaging Het
Chd5 G A 4: 152,378,529 V1380I probably damaging Het
Coro2b C T 9: 62,429,004 G272D probably damaging Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dgki A T 6: 37,063,981 H298Q probably benign Het
Dnmt3b T G 2: 153,684,479 probably null Het
Dzip1 A G 14: 118,922,788 F3L probably damaging Het
Egf A G 3: 129,702,549 S807P probably benign Het
Emc10 C T 7: 44,493,203 R105H Het
Enthd1 T C 15: 80,452,736 E499G probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Fer1l5 T A 1: 36,411,647 M1242K probably benign Het
Gm13083 T A 4: 143,616,152 C276* probably null Het
Gm3415 A G 5: 146,556,269 R36G probably benign Het
Gm5797 C A 14: 7,330,318 M114I possibly damaging Het
Gmppa A T 1: 75,441,824 R284* probably null Het
Homer1 G C 13: 93,349,216 K118N probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kcnc4 G A 3: 107,458,703 A63V probably damaging Het
Kif11 T A 19: 37,384,597 I88N probably damaging Het
Krba1 T C 6: 48,402,897 F9S probably damaging Het
Nckap1 A G 2: 80,520,370 probably null Het
Nox4 A T 7: 87,304,889 Y134F probably benign Het
Olfr1026 T A 2: 85,924,042 M258K probably damaging Het
Olfr1031 T C 2: 85,992,194 C126R probably damaging Het
Olfr1054 G T 2: 86,332,829 H176N possibly damaging Het
Olfr1252 T A 2: 89,721,893 T73S probably benign Het
Olfr562-ps1 T C 7: 102,782,258 S261P probably benign Het
Olfr672 A G 7: 104,996,217 L229P probably damaging Het
Pcdh17 G T 14: 84,447,358 V422L probably benign Het
Pcx T A 19: 4,603,129 V275E probably damaging Het
Pde6h A T 6: 136,961,187 M53L possibly damaging Het
Phactr3 A T 2: 178,334,068 E535D probably damaging Het
Pkn3 C A 2: 30,090,527 T810N probably damaging Het
Pnpla5 T C 15: 84,118,626 E252G probably damaging Het
Psg17 A G 7: 18,814,605 S414P probably benign Het
Pzp T A 6: 128,525,296 Q30L probably benign Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Ret T C 6: 118,164,741 D975G probably benign Het
Sarnp A G 10: 128,877,366 I209V probably benign Het
Sorl1 A T 9: 41,968,622 V2210D probably damaging Het
Stard9 C T 2: 120,702,756 Q3165* probably null Het
Tmem64 A T 4: 15,283,159 I319F probably damaging Het
Vmn1r176 A T 7: 23,835,383 V115D probably damaging Het
Vmn1r2 A G 4: 3,172,623 T181A probably benign Het
Vmn2r2 T C 3: 64,116,913 E749G possibly damaging Het
Vps35 G A 8: 85,284,048 T222I possibly damaging Het
Zfyve16 A G 13: 92,521,204 V733A probably damaging Het
Zranb1 T A 7: 132,949,994 S125T probably benign Het
Other mutations in Zfp532
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02341:Zfp532 APN 18 65624778 missense probably damaging 1.00
IGL02451:Zfp532 APN 18 65623601 missense probably damaging 0.96
IGL02496:Zfp532 APN 18 65624042 missense probably damaging 1.00
R0048:Zfp532 UTSW 18 65644333 missense probably damaging 1.00
R0076:Zfp532 UTSW 18 65685627 missense probably benign 0.07
R0095:Zfp532 UTSW 18 65624784 missense probably damaging 1.00
R0239:Zfp532 UTSW 18 65682985 missense possibly damaging 0.63
R0239:Zfp532 UTSW 18 65682985 missense possibly damaging 0.63
R0539:Zfp532 UTSW 18 65623766 missense probably benign 0.04
R0948:Zfp532 UTSW 18 65623818 missense probably damaging 1.00
R1447:Zfp532 UTSW 18 65624990 missense probably damaging 1.00
R1645:Zfp532 UTSW 18 65687264 missense probably benign 0.26
R1749:Zfp532 UTSW 18 65623484 missense possibly damaging 0.83
R1797:Zfp532 UTSW 18 65625144 missense probably benign 0.04
R1934:Zfp532 UTSW 18 65685611 missense probably damaging 0.97
R1959:Zfp532 UTSW 18 65624492 missense probably damaging 0.99
R2153:Zfp532 UTSW 18 65624927 missense possibly damaging 0.93
R2280:Zfp532 UTSW 18 65624712 missense probably damaging 0.96
R2281:Zfp532 UTSW 18 65624712 missense probably damaging 0.96
R2847:Zfp532 UTSW 18 65656626 missense possibly damaging 0.79
R2848:Zfp532 UTSW 18 65656626 missense possibly damaging 0.79
R4483:Zfp532 UTSW 18 65656565 missense probably benign 0.02
R4938:Zfp532 UTSW 18 65623766 missense probably benign
R4947:Zfp532 UTSW 18 65625066 missense possibly damaging 0.46
R5714:Zfp532 UTSW 18 65623535 missense possibly damaging 0.93
R5920:Zfp532 UTSW 18 65644350 missense probably benign
R6035:Zfp532 UTSW 18 65623934 missense possibly damaging 0.95
R6035:Zfp532 UTSW 18 65623934 missense possibly damaging 0.95
R6092:Zfp532 UTSW 18 65644210 missense probably damaging 1.00
R6170:Zfp532 UTSW 18 65624438 missense probably damaging 0.97
R6180:Zfp532 UTSW 18 65656471 missense probably benign
R6889:Zfp532 UTSW 18 65686990 missense possibly damaging 0.66
R7039:Zfp532 UTSW 18 65638763 missense probably benign 0.44
R7095:Zfp532 UTSW 18 65682898 missense probably benign
R7313:Zfp532 UTSW 18 65623005 missense probably damaging 1.00
R7400:Zfp532 UTSW 18 65638913 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- ATCTTCAGCATCAGCCACGG -3'
(R):5'- GCTGCATTGATTATTGCCTGC -3'

Sequencing Primer
(F):5'- AGCATCAGCCACGGTCCTC -3'
(R):5'- CACTTGGCGGAGTTCAGAG -3'
Posted On2019-06-07