Incidental Mutation 'R6981:Gtf2ird1'
ID557061
Institutional Source Beutler Lab
Gene Symbol Gtf2ird1
Ensembl Gene ENSMUSG00000023079
Gene Namegeneral transcription factor II I repeat domain-containing 1
Synonymsbinding factor for early enhancer, MusTRD1, GTF3, WBSCR11, Tg(Alb1-Myc)166.8Sst, ESTM9, c-myc line 166.8, Alb/c-myc line 166.8, Alb-c-myc line 166.8, Cream1, BEN
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.623) question?
Stock #R6981 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location134357656-134456716 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 134383922 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000073161] [ENSMUST00000074114] [ENSMUST00000100650] [ENSMUST00000100652] [ENSMUST00000100654] [ENSMUST00000111244] [ENSMUST00000111245] [ENSMUST00000167084] [ENSMUST00000171794] [ENSMUST00000200944] [ENSMUST00000202165] [ENSMUST00000202280] [ENSMUST00000202321] [ENSMUST00000202554]
Predicted Effect silent
Transcript: ENSMUST00000073161
SMART Domains Protein: ENSMUSP00000072904
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 814 889 1.7e-34 PFAM
Pfam:GTF2I 917 992 1.7e-34 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000074114
SMART Domains Protein: ENSMUSP00000073752
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.5e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 2.8e-34 PFAM
Pfam:GTF2I 814 889 1.6e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000100650
SMART Domains Protein: ENSMUSP00000098215
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.2e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 787 862 1.8e-34 PFAM
Pfam:GTF2I 890 965 1.8e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000100652
SMART Domains Protein: ENSMUSP00000098217
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.8e-29 PFAM
Pfam:GTF2I 351 425 6.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.3e-34 PFAM
Pfam:GTF2I 690 764 3.3e-32 PFAM
Pfam:GTF2I 814 888 3e-33 PFAM
Pfam:GTF2I 917 991 3e-33 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000100654
SMART Domains Protein: ENSMUSP00000098219
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 716 791 1.5e-34 PFAM
Pfam:GTF2I 819 894 1.5e-34 PFAM
low complexity region 922 945 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000111244
SMART Domains Protein: ENSMUSP00000106875
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.3e-29 PFAM
Pfam:GTF2I 351 425 4.9e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1.7e-34 PFAM
Pfam:GTF2I 690 764 2.5e-32 PFAM
Pfam:GTF2I 787 861 2.3e-33 PFAM
Pfam:GTF2I 890 964 2.3e-33 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000111245
SMART Domains Protein: ENSMUSP00000106876
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.6e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 671 746 2.9e-34 PFAM
Pfam:GTF2I 768 843 1.7e-34 PFAM
Pfam:GTF2I 871 946 1.7e-34 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000167084
SMART Domains Protein: ENSMUSP00000132882
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 690 765 2.7e-34 PFAM
Pfam:GTF2I 814 889 1.5e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000171794
SMART Domains Protein: ENSMUSP00000129392
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.2e-29 PFAM
Pfam:GTF2I 351 426 3.8e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 8.9e-35 PFAM
Pfam:GTF2I 690 765 2.4e-34 PFAM
Pfam:GTF2I 787 862 1.4e-34 PFAM
Pfam:GTF2I 890 965 1.4e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200798
Predicted Effect silent
Transcript: ENSMUST00000200944
SMART Domains Protein: ENSMUSP00000143848
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.9e-29 PFAM
Pfam:GTF2I 351 425 5.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2e-34 PFAM
Pfam:GTF2I 690 764 2.8e-32 PFAM
Pfam:GTF2I 814 888 2.6e-33 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000201441
Predicted Effect silent
Transcript: ENSMUST00000201447
Predicted Effect probably benign
Transcript: ENSMUST00000201495
Predicted Effect probably benign
Transcript: ENSMUST00000201526
Predicted Effect silent
Transcript: ENSMUST00000202165
SMART Domains Protein: ENSMUSP00000144420
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:GTF2I 35 109 7.6e-33 PFAM
Pfam:GTF2I 167 193 4.2e-8 PFAM
Predicted Effect silent
Transcript: ENSMUST00000202280
SMART Domains Protein: ENSMUSP00000143897
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 2.6e-26 PFAM
Pfam:GTF2I 351 425 2.9e-29 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1e-31 PFAM
Pfam:GTF2I 690 764 1.5e-29 PFAM
Pfam:GTF2I 787 861 1.3e-30 PFAM
low complexity region 890 913 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000202321
AA Change: Q19K
Predicted Effect silent
Transcript: ENSMUST00000202554
SMART Domains Protein: ENSMUSP00000143809
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.5e-29 PFAM
Pfam:GTF2I 351 425 6.3e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.2e-34 PFAM
Pfam:GTF2I 671 745 3.2e-32 PFAM
Pfam:GTF2I 768 842 2.9e-33 PFAM
Pfam:GTF2I 871 945 2.9e-33 PFAM
low complexity region 974 997 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygotes for one null allele is embryonic lethal with abnormal yolk sac vasulogenesis, abnormal angiogenesis, and neural tube defect. Other null allele homozygous mice are viable and have behavioral defects and exhibit a mild craniofacial defect withvariable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,293,718 probably benign Het
5031439G07Rik A C 15: 84,949,597 Y419* probably null Het
Abca2 T A 2: 25,444,139 F1809L probably damaging Het
Ache C T 5: 137,291,678 T423I probably benign Het
Acvrl1 A G 15: 101,138,345 T395A probably damaging Het
Ap3b2 A G 7: 81,477,993 I145T probably damaging Het
Arhgef4 A C 1: 34,722,452 Q263P unknown Het
Asgr2 C T 11: 70,096,810 L45F probably damaging Het
Baiap2l1 T A 5: 144,285,579 Y122F possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Car8 A T 4: 8,185,650 probably null Het
Carns1 T C 19: 4,170,082 T385A probably benign Het
Ccdc47 T C 11: 106,202,737 T41A probably benign Het
Ccne1 A T 7: 38,098,573 probably benign Het
Cdh4 C T 2: 179,797,504 T148I probably benign Het
Cep85 C T 4: 134,152,261 R392Q probably damaging Het
Ces1h T C 8: 93,353,495 T464A unknown Het
Cfl1 T A 19: 5,492,616 S41R possibly damaging Het
Crnn T C 3: 93,148,135 V76A probably damaging Het
Cspg4 A G 9: 56,887,101 T707A probably benign Het
Dgkh A T 14: 78,627,742 C53* probably null Het
Dhx34 G T 7: 16,215,330 A391E possibly damaging Het
Dlx1 C A 2: 71,532,353 N201K probably benign Het
Dnah6 T C 6: 73,021,178 E4087G probably benign Het
Dock6 T C 9: 21,845,550 Y134C probably damaging Het
Duox2 A G 2: 122,291,227 V662A possibly damaging Het
Dusp12 A G 1: 170,880,961 F12L probably damaging Het
Eppk1 T C 15: 76,111,037 E548G probably benign Het
Foxj2 A G 6: 122,828,444 I92V probably damaging Het
Foxj2 A G 6: 122,842,839 D562G probably benign Het
Gm17728 A G 17: 9,422,159 R34G probably damaging Het
Gpc6 T C 14: 117,624,548 I292T probably damaging Het
Gpr15 T A 16: 58,718,185 K180N probably benign Het
Hist1h2ah A G 13: 22,035,549 S2P probably benign Het
Hps3 T A 3: 20,022,820 T393S probably damaging Het
Hspa1a A T 17: 34,970,291 probably null Het
Hydin A G 8: 110,531,072 E2378G possibly damaging Het
Ighv1-18 A G 12: 114,682,678 L102P probably damaging Het
Itga5 T A 15: 103,350,226 N814I probably benign Het
Kcnb2 T C 1: 15,710,256 S451P probably damaging Het
Klhl32 T G 4: 24,709,030 I112L probably damaging Het
Knstrn T G 2: 118,834,094 I47R possibly damaging Het
Med23 T A 10: 24,895,824 S581T possibly damaging Het
Mgat5 C T 1: 127,390,851 T361I probably damaging Het
Nipal3 A G 4: 135,479,547 V112A probably damaging Het
Olfr1287 T C 2: 111,449,352 F71L probably benign Het
Olfr1359 A G 13: 21,703,073 E24G probably benign Het
Olfr713 T A 7: 107,036,749 V198D possibly damaging Het
Olfr996 A G 2: 85,579,481 M81V probably benign Het
Paxip1 G A 5: 27,765,768 Q528* probably null Het
Proser2 T C 2: 6,113,990 D14G probably damaging Het
Rp1 T G 1: 4,345,655 I1745L probably benign Het
Rxfp2 G T 5: 150,048,848 probably null Het
Slc45a1 T C 4: 150,638,594 S278G possibly damaging Het
Smurf1 A G 5: 144,886,369 I455T possibly damaging Het
Speg T C 1: 75,430,913 L3188P probably damaging Het
Tcaf3 G T 6: 42,597,125 A51D probably damaging Het
Tecrl T C 5: 83,354,921 N12S possibly damaging Het
Tmem17 T A 11: 22,518,508 I149N possibly damaging Het
Tmem171 A G 13: 98,692,468 V58A possibly damaging Het
Ttn A G 2: 76,861,177 probably benign Het
Ubqln5 A G 7: 104,128,601 S339P probably benign Het
Vmn1r16 T A 6: 57,323,488 I50L probably benign Het
Vmn2r103 A T 17: 19,793,477 Y177F probably benign Het
Zfp28 C A 7: 6,394,693 T709K probably damaging Het
Zfp958 A G 8: 4,626,170 N46S probably benign Het
Zyx T A 6: 42,350,357 V30E unknown Het
Other mutations in Gtf2ird1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Gtf2ird1 APN 5 134358891 missense probably benign 0.03
IGL02477:Gtf2ird1 APN 5 134379978 missense probably damaging 1.00
IGL02659:Gtf2ird1 APN 5 134377041 missense probably damaging 1.00
IGL02752:Gtf2ird1 APN 5 134358824 makesense probably null
IGL02963:Gtf2ird1 APN 5 134389687 missense probably benign 0.05
IGL03328:Gtf2ird1 APN 5 134389129 critical splice donor site probably null
IGL03379:Gtf2ird1 APN 5 134382538 missense possibly damaging 0.94
R0585:Gtf2ird1 UTSW 5 134376942 missense probably damaging 1.00
R1199:Gtf2ird1 UTSW 5 134411064 missense possibly damaging 0.85
R1388:Gtf2ird1 UTSW 5 134395710 missense probably damaging 1.00
R1470:Gtf2ird1 UTSW 5 134395802 critical splice acceptor site probably null
R1470:Gtf2ird1 UTSW 5 134395802 critical splice acceptor site probably null
R1544:Gtf2ird1 UTSW 5 134358918 missense possibly damaging 0.93
R1652:Gtf2ird1 UTSW 5 134395713 missense probably damaging 1.00
R1792:Gtf2ird1 UTSW 5 134366936 intron probably null
R1852:Gtf2ird1 UTSW 5 134382580 unclassified probably null
R1938:Gtf2ird1 UTSW 5 134415245 missense probably damaging 1.00
R1996:Gtf2ird1 UTSW 5 134376886 splice site probably benign
R2020:Gtf2ird1 UTSW 5 134417093 missense probably damaging 1.00
R2025:Gtf2ird1 UTSW 5 134363934 missense probably damaging 1.00
R2849:Gtf2ird1 UTSW 5 134359007 missense probably damaging 1.00
R2964:Gtf2ird1 UTSW 5 134357684 unclassified probably null
R3421:Gtf2ird1 UTSW 5 134388500 missense probably benign 0.41
R4543:Gtf2ird1 UTSW 5 134363900 critical splice donor site probably null
R4569:Gtf2ird1 UTSW 5 134411003 missense probably damaging 1.00
R4664:Gtf2ird1 UTSW 5 134383902 missense probably damaging 1.00
R4665:Gtf2ird1 UTSW 5 134383902 missense probably damaging 1.00
R4666:Gtf2ird1 UTSW 5 134383902 missense probably damaging 1.00
R4680:Gtf2ird1 UTSW 5 134357881 missense probably damaging 1.00
R4709:Gtf2ird1 UTSW 5 134404734 missense probably benign
R4806:Gtf2ird1 UTSW 5 134383896 missense probably damaging 0.99
R4823:Gtf2ird1 UTSW 5 134395722 missense probably damaging 1.00
R4857:Gtf2ird1 UTSW 5 134362544 missense probably damaging 0.96
R4970:Gtf2ird1 UTSW 5 134402184 missense probably damaging 1.00
R4974:Gtf2ird1 UTSW 5 134357831 nonsense probably null
R4975:Gtf2ird1 UTSW 5 134395627 missense probably damaging 1.00
R5072:Gtf2ird1 UTSW 5 134390933 splice site probably null
R5112:Gtf2ird1 UTSW 5 134402184 missense probably damaging 1.00
R5653:Gtf2ird1 UTSW 5 134410967 missense probably damaging 1.00
R5681:Gtf2ird1 UTSW 5 134363318 missense probably damaging 1.00
R5738:Gtf2ird1 UTSW 5 134383818 missense probably damaging 1.00
R5753:Gtf2ird1 UTSW 5 134410983 missense probably damaging 1.00
R6385:Gtf2ird1 UTSW 5 134404690 missense probably benign 0.19
R6580:Gtf2ird1 UTSW 5 134361039 missense probably damaging 1.00
R6787:Gtf2ird1 UTSW 5 134363912 missense probably damaging 0.99
R7208:Gtf2ird1 UTSW 5 134411094 missense probably benign 0.35
R7271:Gtf2ird1 UTSW 5 134404904 missense probably benign 0.01
X0026:Gtf2ird1 UTSW 5 134376102 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCCCAGACCTTACCTCTTG -3'
(R):5'- TTCACATTCCTGGGCTGTACG -3'

Sequencing Primer
(F):5'- CCTCTTGATGACAAACTGGATGCTG -3'
(R):5'- GCTGTACGCCTCCAGACACAG -3'
Posted On2019-06-07