Incidental Mutation 'R6968:Bace1'
ID557084
Institutional Source Beutler Lab
Gene Symbol Bace1
Ensembl Gene ENSMUSG00000032086
Gene Namebeta-site APP cleaving enzyme 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R6968 (G1)
Quality Score165.009
Status Validated
Chromosome9
Chromosomal Location45838580-45864399 bp(+) (GRCm38)
Type of Mutationintron (122 bp from exon)
DNA Base Change (assembly) A to G at 45854965 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000034591] [ENSMUST00000078111]
Predicted Effect probably null
Transcript: ENSMUST00000034591
SMART Domains Protein: ENSMUSP00000034591
Gene: ENSMUSG00000032086

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
Pfam:Asp 74 418 3.1e-46 PFAM
Pfam:TAXi_C 259 417 1.2e-13 PFAM
transmembrane domain 455 477 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000078111
SMART Domains Protein: ENSMUSP00000077249
Gene: ENSMUSG00000032086

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
Pfam:Asp 74 295 9.5e-34 PFAM
Pfam:TAXi_C 290 383 1.5e-8 PFAM
transmembrane domain 421 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159499
SMART Domains Protein: ENSMUSP00000124773
Gene: ENSMUSG00000032086

DomainStartEndE-ValueType
Pfam:Asp 4 61 4.5e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162587
SMART Domains Protein: ENSMUSP00000124960
Gene: ENSMUSG00000032086

DomainStartEndE-ValueType
Pfam:Asp 1 75 3.6e-9 PFAM
Pfam:Asp 78 277 3.3e-22 PFAM
Pfam:TAXi_C 118 276 1.4e-15 PFAM
transmembrane domain 314 336 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients. Homozygous knockout mice for this gene exhibit a wide range of nervous system defects, growth retardation, metabolic abnormalities, and increased neonatal lethality. [provided by RefSeq, Nov 2015]
PHENOTYPE: Some alleles with a targeted mutation exhibit small body size, postnatal lethality, hyperactivity, decreased anxiety, and abnormal APP processing by neurons, while others appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apip C T 2: 103,089,453 L125F possibly damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgef5 T C 6: 43,275,342 V1009A probably benign Het
Armc4 T C 18: 7,273,155 probably null Het
Asah2 A T 19: 32,012,513 I489K probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc162 T C 10: 41,673,844 T348A possibly damaging Het
Cdkn2aip C A 8: 47,713,887 probably benign Het
Cep78 A C 19: 15,981,738 F111V probably benign Het
Chd4 T A 6: 125,108,318 L784Q probably damaging Het
Chrna6 C T 8: 27,406,655 C398Y probably benign Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Cpne2 C T 8: 94,548,502 P46L probably damaging Het
Cyp2w1 A G 5: 139,353,991 Q112R probably damaging Het
Entpd3 A T 9: 120,560,656 E336V probably benign Het
Fbxw28 A C 9: 109,330,788 S197A probably benign Het
Foxk2 T C 11: 121,260,482 F118L possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hinfp A C 9: 44,297,985 S306A probably benign Het
Hspg2 T A 4: 137,535,156 V1663E probably damaging Het
Inpp4b T C 8: 81,844,457 I125T probably benign Het
Jag2 C T 12: 112,914,258 E592K probably benign Het
Krt23 T A 11: 99,481,074 E317V probably damaging Het
Ltbp2 C T 12: 84,789,083 probably null Het
Mast4 G T 13: 102,798,078 N152K probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mier2 G A 10: 79,540,642 probably benign Het
Mmp9 A G 2: 164,952,940 T584A probably benign Het
Necab1 T C 4: 14,957,852 E335G probably damaging Het
Nlrp9b T A 7: 20,049,508 N925K probably damaging Het
Nr4a2 T C 2: 57,108,746 probably null Het
Nrg2 T C 18: 36,196,446 I239V probably benign Het
Nsun2 A G 13: 69,631,290 D562G probably benign Het
Olfr391-ps A G 11: 73,799,379 I126T possibly damaging Het
Ormdl3 T A 11: 98,584,115 M1L probably benign Het
Pcdh10 T A 3: 45,379,542 V97D probably damaging Het
Pde3a T C 6: 141,487,932 F847L probably damaging Het
Ppp1r13b C A 12: 111,833,178 V722F possibly damaging Het
Rhoh A G 5: 65,892,519 D44G possibly damaging Het
Riox1 C T 12: 83,951,373 R228C probably damaging Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Saxo2 T C 7: 82,643,761 T43A probably damaging Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Sema3f C T 9: 107,691,449 probably null Het
Snap25 T C 2: 136,769,770 M64T probably benign Het
Spef2 T C 15: 9,597,340 N1410S probably benign Het
Sstr2 T C 11: 113,624,948 I231T probably damaging Het
Stam A T 2: 14,116,018 H78L probably damaging Het
Suox C T 10: 128,671,833 V109I possibly damaging Het
Syne1 T C 10: 5,117,041 R7075G probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tln1 C T 4: 43,550,217 R482Q probably benign Het
Tnrc6a T C 7: 123,182,427 V1440A probably benign Het
Togaram2 A G 17: 71,709,613 D655G probably damaging Het
Trgv2 A T 13: 19,336,726 I66K probably damaging Het
Vmn1r113 A T 7: 20,787,951 I223F probably damaging Het
Vmn2r62 T A 7: 42,788,442 H206L probably benign Het
Zan T A 5: 137,461,813 Y1272F unknown Het
Zfp39 T C 11: 58,891,480 H152R probably benign Het
Zfp41 T A 15: 75,618,461 Y87* probably null Het
Zfp933 A T 4: 147,826,197 L314H probably damaging Het
Other mutations in Bace1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Bace1 APN 9 45839290 critical splice donor site probably null
IGL03378:Bace1 APN 9 45858901 splice site probably null
R0071:Bace1 UTSW 9 45854699 intron probably benign
R1561:Bace1 UTSW 9 45839194 missense probably benign 0.08
R1819:Bace1 UTSW 9 45857162 missense possibly damaging 0.48
R2097:Bace1 UTSW 9 45860222 missense probably benign 0.00
R4067:Bace1 UTSW 9 45854664 missense probably damaging 1.00
R4864:Bace1 UTSW 9 45854811 missense probably damaging 1.00
R5814:Bace1 UTSW 9 45860264 missense probably damaging 1.00
R5818:Bace1 UTSW 9 45859049 missense possibly damaging 0.94
R6365:Bace1 UTSW 9 45854676 nonsense probably null
R7188:Bace1 UTSW 9 45856095 missense probably benign
X0020:Bace1 UTSW 9 45860182 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTCATCAATGGTTCCAACTGGG -3'
(R):5'- CTTGAGAATCTGTGTACCTTTAAGAA -3'

Sequencing Primer
(F):5'- TCCAACTGGGAGGGCATC -3'
(R):5'- CAGCCTGGTCTACGTAGAGAGTTAC -3'
Posted On2019-06-12