Incidental Mutation 'R7043:Ccna2'
ID557110
Institutional Source Beutler Lab
Gene Symbol Ccna2
Ensembl Gene ENSMUSG00000027715
Gene Namecyclin A2
SynonymsCycA2, Ccn-1, Ccna, Ccn1, Cyca
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7043 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location36564865-36572150 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to C at 36570153 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029269] [ENSMUST00000029270] [ENSMUST00000040148] [ENSMUST00000108155] [ENSMUST00000108156] [ENSMUST00000147380] [ENSMUST00000196316]
Predicted Effect probably benign
Transcript: ENSMUST00000029269
SMART Domains Protein: ENSMUSP00000029269
Gene: ENSMUSG00000027714

DomainStartEndE-ValueType
Pfam:RNase_PH 31 163 1.7e-25 PFAM
Pfam:RNase_PH_C 189 255 3.4e-14 PFAM
low complexity region 308 324 N/A INTRINSIC
low complexity region 348 366 N/A INTRINSIC
low complexity region 396 406 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029270
SMART Domains Protein: ENSMUSP00000029270
Gene: ENSMUSG00000027715

DomainStartEndE-ValueType
Pfam:Cyclin_N2 22 157 7.2e-50 PFAM
CYCLIN 206 290 1.07e-28 SMART
Cyclin_C 299 417 4.09e-31 SMART
CYCLIN 303 386 1.02e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040148
SMART Domains Protein: ENSMUSP00000047273
Gene: ENSMUSG00000037325

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108155
SMART Domains Protein: ENSMUSP00000103790
Gene: ENSMUSG00000037325

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108156
SMART Domains Protein: ENSMUSP00000103791
Gene: ENSMUSG00000037325

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131316
SMART Domains Protein: ENSMUSP00000117235
Gene: ENSMUSG00000027714

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 47 65 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000147380
AA Change: D148G
Predicted Effect probably benign
Transcript: ENSMUST00000196316
SMART Domains Protein: ENSMUSP00000142946
Gene: ENSMUSG00000027715

DomainStartEndE-ValueType
CYCLIN 69 153 6.6e-31 SMART
Cyclin_C 162 280 2e-35 SMART
CYCLIN 166 249 6.1e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members function as regulators of the cell cycle. This protein binds and activates cyclin-dependent kinase 2 and thus promotes transition through G1/S and G2/M. [provided by RefSeq, Aug 2016]
PHENOTYPE: Embryos homozygous for a targeted mutation implant in the uterine wall, but fail to develop past 5.5 dpc. Notably, mutant embryos develop normally from the four-cell to the post-implantation stage in the absence of detectable maternally-derived gene products. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,332 D832G possibly damaging Het
Abca17 A G 17: 24,265,500 L1596P probably damaging Het
Actr3b A G 5: 25,849,938 M329V probably benign Het
Avpr1a C T 10: 122,449,681 R293C probably damaging Het
Bdp1 A T 13: 100,078,707 C390S probably benign Het
C2cd2l A T 9: 44,316,551 M131K probably damaging Het
Cd53 T C 3: 106,763,261 D152G probably damaging Het
Cdpf1 A T 15: 85,808,284 V66E probably null Het
Chd9 G T 8: 91,034,215 probably benign Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Dst A G 1: 34,257,911 T5794A probably damaging Het
Eif2s1 G T 12: 78,877,108 R113L probably damaging Het
Eif5 A G 12: 111,544,596 D423G probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
F7 A T 8: 13,033,997 R227S probably benign Het
Gm14496 T G 2: 182,000,327 I597S possibly damaging Het
Gpr85 T A 6: 13,835,877 N343Y probably damaging Het
H2-T23 A T 17: 36,031,911 S112T probably damaging Het
Itga9 C T 9: 118,769,116 P573S probably damaging Het
Kcnb2 A T 1: 15,312,926 M159L probably benign Het
Kmt5b T A 19: 3,815,220 S738R possibly damaging Het
Lrp1b T C 2: 40,922,414 N2393S possibly damaging Het
Mme T A 3: 63,345,217 Y427* probably null Het
Naip1 A G 13: 100,426,914 V581A probably damaging Het
Ndel1 A G 11: 68,822,624 L329P possibly damaging Het
Nthl1 T G 17: 24,638,670 V281G probably benign Het
Olfr597 C A 7: 103,321,085 probably benign Het
Per2 G T 1: 91,419,408 H1197Q probably benign Het
Plec G A 15: 76,209,128 probably benign Het
Prpf6 A T 2: 181,649,504 H704L probably benign Het
Recql5 C T 11: 115,930,676 probably null Het
Rimbp3 G A 16: 17,211,108 V799M probably damaging Het
Sema3f C T 9: 107,691,400 A169T possibly damaging Het
Serpinb9f T C 13: 33,325,987 I54T possibly damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc35g3 T C 11: 69,761,650 D12G probably benign Het
Sptbn1 A G 11: 30,103,323 V2252A probably benign Het
Stab2 T C 10: 86,870,246 N1750S probably damaging Het
Supt5 C A 7: 28,320,010 R543L probably benign Het
Syne1 T C 10: 5,072,193 E7806G possibly damaging Het
Syt12 T A 19: 4,451,021 M334L probably benign Het
Tk1 A G 11: 117,815,953 *234R probably null Het
Trp73 T G 4: 154,067,007 probably null Het
Ttn A G 2: 76,897,133 probably benign Het
Vmn2r11 T C 5: 109,052,232 I452V probably benign Het
Wwox G T 8: 114,679,838 V190L probably damaging Het
Wwp2 A G 8: 107,457,900 H80R probably benign Het
Zc3h3 A G 15: 75,809,636 I532T probably damaging Het
Zfp280d A G 9: 72,319,257 K328E probably damaging Het
Zfp365 A G 10: 67,909,826 S41P probably damaging Het
Other mutations in Ccna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1170:Ccna2 UTSW 3 36568970 splice site probably benign
R1559:Ccna2 UTSW 3 36570730 splice site probably benign
R2122:Ccna2 UTSW 3 36568726 missense probably damaging 1.00
R3718:Ccna2 UTSW 3 36566238 missense probably benign 0.14
R4749:Ccna2 UTSW 3 36566242 missense probably benign 0.00
R5037:Ccna2 UTSW 3 36571003 start gained probably benign
R6499:Ccna2 UTSW 3 36570963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTTCAGTTATCTTGAGATGGGAG -3'
(R):5'- ATCTTTAACCGGCAGGAGGG -3'

Sequencing Primer
(F):5'- TGTCTAGCCAAATCGCTGAG -3'
(R):5'- CAGGAGGGCACTGCAAACC -3'
Posted On2019-06-21