Incidental Mutation 'R7154:Cpa6'
ID557118
Institutional Source Beutler Lab
Gene Symbol Cpa6
Ensembl Gene ENSMUSG00000042501
Gene Namecarboxypeptidase A6
Synonyms9030616D13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7154 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location10324720-10719945 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10337469 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 281 (D281V)
Ref Sequence ENSEMBL: ENSMUSP00000035435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035577] [ENSMUST00000153695]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035577
AA Change: D281V

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035435
Gene: ENSMUSG00000042501
AA Change: D281V

DomainStartEndE-ValueType
Pfam:Propep_M14 43 119 3.1e-17 PFAM
Zn_pept 139 421 2.19e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153695
SMART Domains Protein: ENSMUSP00000118341
Gene: ENSMUSG00000042501

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
SCOP:d1kwma2 31 64 2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to the metallocarboxypeptidase family of proteins that catalyze the release of a C-terminal amino acid from the target protein. The encoded preproprotein undergoes proteolytic cleavage to yield the mature form which is thought to play a role in cell migration. In humans, this protein regulates neuropeptides in the brain and mutations in this gene are associated with a recessive familial form of febrile seizures and with temporal lobe epilepsy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Adgre1 G A 17: 57,444,087 probably null Het
Agap2 A G 10: 127,091,655 D1135G probably benign Het
Akp3 T C 1: 87,125,224 L45P probably damaging Het
Arfgap3 A T 15: 83,336,704 W71R probably damaging Het
Asic3 G A 5: 24,413,662 probably benign Het
Asph A T 4: 9,630,930 N139K possibly damaging Het
Atr T A 9: 95,865,045 C127S probably benign Het
Auts2 A T 5: 131,451,893 S255T Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Cacnb1 A G 11: 98,005,133 L443P probably damaging Het
Cbfa2t3 G A 8: 122,638,144 Q300* probably null Het
Ccer1 A T 10: 97,694,339 D288V unknown Het
Col18a1 G A 10: 77,072,965 P611S probably benign Het
Cyp2e1 A G 7: 140,770,137 Y245C probably damaging Het
Cyp4a31 T C 4: 115,574,766 probably null Het
Entpd1 T C 19: 40,724,986 Y188H probably damaging Het
Epb42 T C 2: 121,033,362 D111G probably benign Het
Espl1 A G 15: 102,324,049 D2064G probably damaging Het
Fat3 A C 9: 15,996,864 V2614G probably damaging Het
Fos A T 12: 85,474,157 M40L probably benign Het
Frmd4b T A 6: 97,306,746 E434V probably damaging Het
Galnt6 A T 15: 100,693,464 D586E probably benign Het
Gapvd1 T C 2: 34,725,063 K474R probably damaging Het
Gimap8 T A 6: 48,656,188 F314I probably damaging Het
Gm10696 A G 3: 94,176,219 I95T probably benign Het
Gm11639 T A 11: 104,699,140 probably null Het
Gm14393 T G 2: 175,061,783 K110N probably damaging Het
Gm4131 C A 14: 62,480,933 A75S probably damaging Het
Heatr6 G A 11: 83,777,241 V854I probably benign Het
Hic2 T A 16: 17,258,942 M545K possibly damaging Het
Ip6k1 A G 9: 108,045,662 Y331C probably damaging Het
Kalrn C T 16: 34,212,157 probably null Het
Kxd1 T C 8: 70,515,434 K88E probably damaging Het
Lrrc37a A C 11: 103,502,856 V581G probably benign Het
Mex3d A T 10: 80,386,750 V224E Het
Mtx2 T A 2: 74,876,418 C246S probably damaging Het
Mybbp1a A G 11: 72,447,642 probably null Het
Myh6 A G 14: 54,960,307 I458T probably benign Het
Ndufs6 A G 13: 73,320,292 V96A possibly damaging Het
Nemf A T 12: 69,316,741 probably null Het
Notch1 T C 2: 26,459,938 S2397G probably benign Het
Olfr1229 A G 2: 89,282,860 I91T probably damaging Het
Olfr522 T C 7: 140,162,084 I289V probably benign Het
Osbpl1a T C 18: 12,768,592 E619G probably benign Het
Pfkl T C 10: 78,001,455 R95G probably benign Het
Plat T A 8: 22,778,505 I391K possibly damaging Het
Ppp1r21 A G 17: 88,554,886 H244R probably damaging Het
Rapgef3 G C 15: 97,753,877 H578Q probably benign Het
Rnf145 C A 11: 44,524,995 N12K probably damaging Het
Sfxn5 C T 6: 85,332,423 C100Y unknown Het
Sh3rf1 T A 8: 61,372,714 L581Q possibly damaging Het
Sipa1l2 T C 8: 125,468,339 K887E probably benign Het
Stard9 C A 2: 120,701,314 T2684N probably benign Het
Stard9 A C 2: 120,704,542 Q3760P probably benign Het
Stpg2 A G 3: 139,215,295 E87G probably benign Het
Syne2 A G 12: 76,059,457 Q792R possibly damaging Het
Taf7 T C 18: 37,642,548 D322G possibly damaging Het
Tbc1d1 A G 5: 64,173,813 S112G possibly damaging Het
Tbx3 A G 5: 119,672,028 M5V possibly damaging Het
Tmem45b A T 9: 31,428,032 I215N possibly damaging Het
Tpd52 G A 3: 8,963,856 Q43* probably null Het
Trpa1 T A 1: 14,882,233 N858I possibly damaging Het
Ttc30b C T 2: 75,938,061 R116H possibly damaging Het
Ttll5 A G 12: 85,925,764 D767G probably damaging Het
Vmn2r3 G A 3: 64,287,311 T62I probably benign Het
Wdr59 A T 8: 111,458,735 N874K Het
Other mutations in Cpa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Cpa6 APN 1 10483994 missense probably damaging 1.00
IGL00933:Cpa6 APN 1 10337370 missense probably benign 0.03
IGL01710:Cpa6 APN 1 10325272 missense probably damaging 0.99
IGL02211:Cpa6 APN 1 10595636 missense possibly damaging 0.83
IGL02504:Cpa6 APN 1 10488919 missense probably benign 0.19
R0487:Cpa6 UTSW 1 10409262 missense possibly damaging 0.77
R1260:Cpa6 UTSW 1 10325319 splice site probably null
R2154:Cpa6 UTSW 1 10337322 missense probably damaging 1.00
R4705:Cpa6 UTSW 1 10481058 missense probably benign 0.03
R4788:Cpa6 UTSW 1 10408277 missense possibly damaging 0.95
R4872:Cpa6 UTSW 1 10595618 critical splice donor site probably null
R4941:Cpa6 UTSW 1 10409337 missense probably benign 0.25
R5656:Cpa6 UTSW 1 10329514 missense probably benign 0.19
R5969:Cpa6 UTSW 1 10488883 missense probably benign 0.15
R6019:Cpa6 UTSW 1 10595643 missense possibly damaging 0.88
R6322:Cpa6 UTSW 1 10477121 missense possibly damaging 0.77
R6958:Cpa6 UTSW 1 10595688 missense probably damaging 1.00
R7274:Cpa6 UTSW 1 10409299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTTACCACACAGCTAAAATTGGGG -3'
(R):5'- TCCTACAGTGCAGGCTTGTATC -3'

Sequencing Primer
(F):5'- CACAGCTAAAATTGGGGATTGTTGC -3'
(R):5'- AGGCTTGTATCTGCTCAGAATTTTC -3'
Posted On2019-06-26