Incidental Mutation 'R7154:Cyp4a31'
ID557135
Institutional Source Beutler Lab
Gene Symbol Cyp4a31
Ensembl Gene ENSMUSG00000028712
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7154 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location115563649-115579015 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 115574766 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030480] [ENSMUST00000030486] [ENSMUST00000126645]
Predicted Effect probably null
Transcript: ENSMUST00000030480
SMART Domains Protein: ENSMUSP00000030480
Gene: ENSMUSG00000028712

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 51 415 3.6e-97 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000030486
SMART Domains Protein: ENSMUSP00000030486
Gene: ENSMUSG00000028712

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 51 504 2.6e-134 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126645
SMART Domains Protein: ENSMUSP00000117129
Gene: ENSMUSG00000028712

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 51 340 4.3e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Adgre1 G A 17: 57,444,087 probably null Het
Agap2 A G 10: 127,091,655 D1135G probably benign Het
Akp3 T C 1: 87,125,224 L45P probably damaging Het
Arfgap3 A T 15: 83,336,704 W71R probably damaging Het
Asic3 G A 5: 24,413,662 probably benign Het
Asph A T 4: 9,630,930 N139K possibly damaging Het
Atr T A 9: 95,865,045 C127S probably benign Het
Auts2 A T 5: 131,451,893 S255T Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Cacnb1 A G 11: 98,005,133 L443P probably damaging Het
Cbfa2t3 G A 8: 122,638,144 Q300* probably null Het
Ccer1 A T 10: 97,694,339 D288V unknown Het
Col18a1 G A 10: 77,072,965 P611S probably benign Het
Cpa6 T A 1: 10,337,469 D281V possibly damaging Het
Cyp2e1 A G 7: 140,770,137 Y245C probably damaging Het
Entpd1 T C 19: 40,724,986 Y188H probably damaging Het
Epb42 T C 2: 121,033,362 D111G probably benign Het
Espl1 A G 15: 102,324,049 D2064G probably damaging Het
Fat3 A C 9: 15,996,864 V2614G probably damaging Het
Fos A T 12: 85,474,157 M40L probably benign Het
Frmd4b T A 6: 97,306,746 E434V probably damaging Het
Galnt6 A T 15: 100,693,464 D586E probably benign Het
Gapvd1 T C 2: 34,725,063 K474R probably damaging Het
Gimap8 T A 6: 48,656,188 F314I probably damaging Het
Gm10696 A G 3: 94,176,219 I95T probably benign Het
Gm11639 T A 11: 104,699,140 probably null Het
Gm14393 T G 2: 175,061,783 K110N probably damaging Het
Gm4131 C A 14: 62,480,933 A75S probably damaging Het
Heatr6 G A 11: 83,777,241 V854I probably benign Het
Hic2 T A 16: 17,258,942 M545K possibly damaging Het
Ip6k1 A G 9: 108,045,662 Y331C probably damaging Het
Kalrn C T 16: 34,212,157 probably null Het
Kxd1 T C 8: 70,515,434 K88E probably damaging Het
Lrrc37a A C 11: 103,502,856 V581G probably benign Het
Mex3d A T 10: 80,386,750 V224E Het
Mtx2 T A 2: 74,876,418 C246S probably damaging Het
Mybbp1a A G 11: 72,447,642 probably null Het
Myh6 A G 14: 54,960,307 I458T probably benign Het
Ndufs6 A G 13: 73,320,292 V96A possibly damaging Het
Nemf A T 12: 69,316,741 probably null Het
Notch1 T C 2: 26,459,938 S2397G probably benign Het
Olfr1229 A G 2: 89,282,860 I91T probably damaging Het
Olfr522 T C 7: 140,162,084 I289V probably benign Het
Osbpl1a T C 18: 12,768,592 E619G probably benign Het
Pfkl T C 10: 78,001,455 R95G probably benign Het
Plat T A 8: 22,778,505 I391K possibly damaging Het
Ppp1r21 A G 17: 88,554,886 H244R probably damaging Het
Rapgef3 G C 15: 97,753,877 H578Q probably benign Het
Rnf145 C A 11: 44,524,995 N12K probably damaging Het
Sfxn5 C T 6: 85,332,423 C100Y unknown Het
Sh3rf1 T A 8: 61,372,714 L581Q possibly damaging Het
Sipa1l2 T C 8: 125,468,339 K887E probably benign Het
Stard9 C A 2: 120,701,314 T2684N probably benign Het
Stard9 A C 2: 120,704,542 Q3760P probably benign Het
Stpg2 A G 3: 139,215,295 E87G probably benign Het
Syne2 A G 12: 76,059,457 Q792R possibly damaging Het
Taf7 T C 18: 37,642,548 D322G possibly damaging Het
Tbc1d1 A G 5: 64,173,813 S112G possibly damaging Het
Tbx3 A G 5: 119,672,028 M5V possibly damaging Het
Tmem45b A T 9: 31,428,032 I215N possibly damaging Het
Tpd52 G A 3: 8,963,856 Q43* probably null Het
Trpa1 T A 1: 14,882,233 N858I possibly damaging Het
Ttc30b C T 2: 75,938,061 R116H possibly damaging Het
Ttll5 A G 12: 85,925,764 D767G probably damaging Het
Vmn2r3 G A 3: 64,287,311 T62I probably benign Het
Wdr59 A T 8: 111,458,735 N874K Het
Other mutations in Cyp4a31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Cyp4a31 APN 4 115574974 unclassified probably benign
IGL01682:Cyp4a31 APN 4 115578031 missense probably damaging 0.97
IGL02112:Cyp4a31 APN 4 115570983 missense probably damaging 1.00
IGL02292:Cyp4a31 APN 4 115566501 missense probably damaging 0.98
IGL02343:Cyp4a31 APN 4 115563829 missense probably damaging 1.00
IGL02508:Cyp4a31 APN 4 115571064 missense probably damaging 1.00
IGL03094:Cyp4a31 APN 4 115578108 utr 3 prime probably benign
IGL03493:Cyp4a31 APN 4 115570755 splice site probably null
R0400:Cyp4a31 UTSW 4 115563718 start codon destroyed probably null 1.00
R1263:Cyp4a31 UTSW 4 115574711 missense probably benign 0.01
R1508:Cyp4a31 UTSW 4 115565053 missense possibly damaging 0.53
R1523:Cyp4a31 UTSW 4 115569754 missense probably benign 0.23
R1822:Cyp4a31 UTSW 4 115566613 splice site probably null
R1832:Cyp4a31 UTSW 4 115569731 missense probably benign
R1872:Cyp4a31 UTSW 4 115574736 missense probably damaging 0.99
R2351:Cyp4a31 UTSW 4 115571313 missense possibly damaging 0.95
R2426:Cyp4a31 UTSW 4 115571016 missense probably damaging 0.98
R2993:Cyp4a31 UTSW 4 115569820 missense probably benign 0.03
R3743:Cyp4a31 UTSW 4 115566519 missense possibly damaging 0.95
R3812:Cyp4a31 UTSW 4 115566509 missense probably benign
R3963:Cyp4a31 UTSW 4 115574772 unclassified probably benign
R4211:Cyp4a31 UTSW 4 115565013 missense probably benign 0.01
R4814:Cyp4a31 UTSW 4 115570269 missense probably damaging 1.00
R6245:Cyp4a31 UTSW 4 115571348 missense possibly damaging 0.91
R6255:Cyp4a31 UTSW 4 115574920 missense possibly damaging 0.82
R6330:Cyp4a31 UTSW 4 115563877 missense probably damaging 0.99
R6433:Cyp4a31 UTSW 4 115570269 missense probably damaging 1.00
R6602:Cyp4a31 UTSW 4 115569707 critical splice acceptor site probably null
R6844:Cyp4a31 UTSW 4 115563792 missense probably null 0.00
R7300:Cyp4a31 UTSW 4 115570271 missense probably benign 0.03
X0020:Cyp4a31 UTSW 4 115565109 missense probably benign 0.06
X0021:Cyp4a31 UTSW 4 115577961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACCCAAGTATCTTGTGCAG -3'
(R):5'- TCCATCATCATACACAGGATGTCTC -3'

Sequencing Primer
(F):5'- CCAAGTATCTTGTGCAGGCATATC -3'
(R):5'- TACACAGGATGTCTCACCTGG -3'
Posted On2019-06-26