Incidental Mutation 'R7154:Frmd4b'
ID557142
Institutional Source Beutler Lab
Gene Symbol Frmd4b
Ensembl Gene ENSMUSG00000030064
Gene NameFERM domain containing 4B
Synonyms6030440G05Rik, GRSP1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_145148.2; MGI:2141794

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7154 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location97286867-97617541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97306746 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 434 (E434V)
Ref Sequence ENSEMBL: ENSMUSP00000032146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032146] [ENSMUST00000113355] [ENSMUST00000113359]
Predicted Effect probably damaging
Transcript: ENSMUST00000032146
AA Change: E434V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032146
Gene: ENSMUSG00000030064
AA Change: E434V

DomainStartEndE-ValueType
B41 55 260 7.4e-35 SMART
FERM_C 264 365 8.7e-26 SMART
Pfam:DUF3338 395 529 4.5e-55 PFAM
coiled coil region 534 558 N/A INTRINSIC
low complexity region 571 592 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 941 958 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113355
AA Change: E380V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108982
Gene: ENSMUSG00000030064
AA Change: E380V

DomainStartEndE-ValueType
B41 1 206 4.5e-37 SMART
FERM_C 210 311 4.1e-30 SMART
Pfam:DUF3338 340 476 6.9e-58 PFAM
coiled coil region 480 504 N/A INTRINSIC
low complexity region 517 538 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
low complexity region 887 904 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113359
AA Change: E388V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108986
Gene: ENSMUSG00000030064
AA Change: E388V

DomainStartEndE-ValueType
B41 9 214 7.4e-35 SMART
FERM_C 218 319 8.7e-26 SMART
Pfam:DUF3338 348 484 8e-61 PFAM
coiled coil region 488 512 N/A INTRINSIC
low complexity region 525 546 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
low complexity region 895 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GRP1-binding protein which contains a FERM protein interaction domain as well as two coiled coil domains. This protein may play a role as a scaffolding protein. [provided by RefSeq, Mar 2014]
Allele List at MGI

All alleles(24) : Targeted(2) Gene trapped(22)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Adgre1 G A 17: 57,444,087 probably null Het
Agap2 A G 10: 127,091,655 D1135G probably benign Het
Akp3 T C 1: 87,125,224 L45P probably damaging Het
Arfgap3 A T 15: 83,336,704 W71R probably damaging Het
Asic3 G A 5: 24,413,662 probably benign Het
Asph A T 4: 9,630,930 N139K possibly damaging Het
Atr T A 9: 95,865,045 C127S probably benign Het
Auts2 A T 5: 131,451,893 S255T Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Cacnb1 A G 11: 98,005,133 L443P probably damaging Het
Cbfa2t3 G A 8: 122,638,144 Q300* probably null Het
Ccer1 A T 10: 97,694,339 D288V unknown Het
Col18a1 G A 10: 77,072,965 P611S probably benign Het
Cpa6 T A 1: 10,337,469 D281V possibly damaging Het
Cyp2e1 A G 7: 140,770,137 Y245C probably damaging Het
Cyp4a31 T C 4: 115,574,766 probably null Het
Entpd1 T C 19: 40,724,986 Y188H probably damaging Het
Epb42 T C 2: 121,033,362 D111G probably benign Het
Espl1 A G 15: 102,324,049 D2064G probably damaging Het
Fat3 A C 9: 15,996,864 V2614G probably damaging Het
Fos A T 12: 85,474,157 M40L probably benign Het
Galnt6 A T 15: 100,693,464 D586E probably benign Het
Gapvd1 T C 2: 34,725,063 K474R probably damaging Het
Gimap8 T A 6: 48,656,188 F314I probably damaging Het
Gm10696 A G 3: 94,176,219 I95T probably benign Het
Gm11639 T A 11: 104,699,140 probably null Het
Gm14393 T G 2: 175,061,783 K110N probably damaging Het
Gm4131 C A 14: 62,480,933 A75S probably damaging Het
Heatr6 G A 11: 83,777,241 V854I probably benign Het
Hic2 T A 16: 17,258,942 M545K possibly damaging Het
Ip6k1 A G 9: 108,045,662 Y331C probably damaging Het
Kalrn C T 16: 34,212,157 probably null Het
Kxd1 T C 8: 70,515,434 K88E probably damaging Het
Lrrc37a A C 11: 103,502,856 V581G probably benign Het
Mex3d A T 10: 80,386,750 V224E Het
Mtx2 T A 2: 74,876,418 C246S probably damaging Het
Mybbp1a A G 11: 72,447,642 probably null Het
Myh6 A G 14: 54,960,307 I458T probably benign Het
Ndufs6 A G 13: 73,320,292 V96A possibly damaging Het
Nemf A T 12: 69,316,741 probably null Het
Notch1 T C 2: 26,459,938 S2397G probably benign Het
Olfr1229 A G 2: 89,282,860 I91T probably damaging Het
Olfr522 T C 7: 140,162,084 I289V probably benign Het
Osbpl1a T C 18: 12,768,592 E619G probably benign Het
Pfkl T C 10: 78,001,455 R95G probably benign Het
Plat T A 8: 22,778,505 I391K possibly damaging Het
Ppp1r21 A G 17: 88,554,886 H244R probably damaging Het
Rapgef3 G C 15: 97,753,877 H578Q probably benign Het
Rnf145 C A 11: 44,524,995 N12K probably damaging Het
Sfxn5 C T 6: 85,332,423 C100Y unknown Het
Sh3rf1 T A 8: 61,372,714 L581Q possibly damaging Het
Sipa1l2 T C 8: 125,468,339 K887E probably benign Het
Stard9 C A 2: 120,701,314 T2684N probably benign Het
Stard9 A C 2: 120,704,542 Q3760P probably benign Het
Stpg2 A G 3: 139,215,295 E87G probably benign Het
Syne2 A G 12: 76,059,457 Q792R possibly damaging Het
Taf7 T C 18: 37,642,548 D322G possibly damaging Het
Tbc1d1 A G 5: 64,173,813 S112G possibly damaging Het
Tbx3 A G 5: 119,672,028 M5V possibly damaging Het
Tmem45b A T 9: 31,428,032 I215N possibly damaging Het
Tpd52 G A 3: 8,963,856 Q43* probably null Het
Trpa1 T A 1: 14,882,233 N858I possibly damaging Het
Ttc30b C T 2: 75,938,061 R116H possibly damaging Het
Ttll5 A G 12: 85,925,764 D767G probably damaging Het
Vmn2r3 G A 3: 64,287,311 T62I probably benign Het
Wdr59 A T 8: 111,458,735 N874K Het
Other mutations in Frmd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Frmd4b APN 6 97308060 missense probably damaging 1.00
IGL01478:Frmd4b APN 6 97328293 missense probably damaging 1.00
IGL01760:Frmd4b APN 6 97308702 missense probably damaging 1.00
IGL01777:Frmd4b APN 6 97295944 missense probably benign 0.03
IGL01960:Frmd4b APN 6 97295780 missense possibly damaging 0.93
IGL02408:Frmd4b APN 6 97295809 missense probably damaging 1.00
IGL02429:Frmd4b APN 6 97325429 splice site probably benign
IGL02525:Frmd4b APN 6 97412533 missense probably damaging 1.00
IGL02618:Frmd4b APN 6 97308105 nonsense probably null
IGL03051:Frmd4b APN 6 97295982 nonsense probably null
IGL03120:Frmd4b APN 6 97396245 missense possibly damaging 0.88
IGL03218:Frmd4b APN 6 97308114 missense probably benign 0.01
IGL03260:Frmd4b APN 6 97396224 missense probably damaging 1.00
IGL02984:Frmd4b UTSW 6 97296260 missense probably damaging 0.96
P0031:Frmd4b UTSW 6 97354030 missense probably damaging 1.00
R0055:Frmd4b UTSW 6 97323649 splice site probably benign
R0055:Frmd4b UTSW 6 97323649 splice site probably benign
R0058:Frmd4b UTSW 6 97423499 missense probably damaging 1.00
R0255:Frmd4b UTSW 6 97308086 missense probably damaging 1.00
R0437:Frmd4b UTSW 6 97423463 missense probably damaging 1.00
R0594:Frmd4b UTSW 6 97325426 splice site probably benign
R1525:Frmd4b UTSW 6 97296386 missense probably damaging 0.97
R1640:Frmd4b UTSW 6 97308673 missense possibly damaging 0.91
R1768:Frmd4b UTSW 6 97306764 missense possibly damaging 0.68
R1923:Frmd4b UTSW 6 97288454 missense probably benign 0.33
R2056:Frmd4b UTSW 6 97412487 critical splice donor site probably null
R2192:Frmd4b UTSW 6 97487616 missense probably damaging 0.98
R3809:Frmd4b UTSW 6 97323729 missense possibly damaging 0.49
R3831:Frmd4b UTSW 6 97412525 nonsense probably null
R4466:Frmd4b UTSW 6 97323653 critical splice donor site probably null
R4536:Frmd4b UTSW 6 97310732 missense possibly damaging 0.57
R4652:Frmd4b UTSW 6 97295755 missense probably benign 0.38
R4679:Frmd4b UTSW 6 97295666 missense possibly damaging 0.94
R4735:Frmd4b UTSW 6 97459259 start gained probably benign
R4793:Frmd4b UTSW 6 97295861 missense probably damaging 0.99
R4940:Frmd4b UTSW 6 97298090 missense probably damaging 1.00
R4948:Frmd4b UTSW 6 97306730 missense probably benign 0.06
R5092:Frmd4b UTSW 6 97295980 missense probably damaging 0.98
R5119:Frmd4b UTSW 6 97300314 missense probably benign 0.03
R5289:Frmd4b UTSW 6 97302348 splice site probably null
R5610:Frmd4b UTSW 6 97306791 missense probably benign
R5690:Frmd4b UTSW 6 97353203 missense possibly damaging 0.56
R6248:Frmd4b UTSW 6 97459212 missense probably benign 0.10
R6437:Frmd4b UTSW 6 97296267 missense probably damaging 1.00
R6459:Frmd4b UTSW 6 97487640 missense probably damaging 1.00
R6825:Frmd4b UTSW 6 97325476 missense possibly damaging 0.89
R6964:Frmd4b UTSW 6 97305197 missense probably damaging 1.00
R7110:Frmd4b UTSW 6 97296231 nonsense probably null
X0020:Frmd4b UTSW 6 97305365 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGGATACTCCTTTGGCATTC -3'
(R):5'- GTGAACGGTCTCCTGGTTTC -3'

Sequencing Primer
(F):5'- GCATTCTGCCCGTGAGCTC -3'
(R):5'- GGTTTCCTTTCATTATGTTCAGAAAC -3'
Posted On2019-06-26