Incidental Mutation 'R7154:Sipa1l2'
ID557150
Institutional Source Beutler Lab
Gene Symbol Sipa1l2
Ensembl Gene ENSMUSG00000001995
Gene Namesignal-induced proliferation-associated 1 like 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R7154 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location125418063-125569808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125468339 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 887 (K887E)
Ref Sequence ENSEMBL: ENSMUSP00000104405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]
Predicted Effect probably benign
Transcript: ENSMUST00000108775
AA Change: K887E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: K887E

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
Pfam:Rap_GAP 625 807 2.6e-67 PFAM
PDZ 960 1026 6.47e-9 SMART
low complexity region 1091 1103 N/A INTRINSIC
low complexity region 1120 1138 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
low complexity region 1299 1312 N/A INTRINSIC
low complexity region 1321 1329 N/A INTRINSIC
low complexity region 1334 1355 N/A INTRINSIC
low complexity region 1404 1418 N/A INTRINSIC
Pfam:SPAR_C 1421 1666 2.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212168
AA Change: K887E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000212987
AA Change: K887E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Adgre1 G A 17: 57,444,087 probably null Het
Agap2 A G 10: 127,091,655 D1135G probably benign Het
Akp3 T C 1: 87,125,224 L45P probably damaging Het
Arfgap3 A T 15: 83,336,704 W71R probably damaging Het
Asic3 G A 5: 24,413,662 probably benign Het
Asph A T 4: 9,630,930 N139K possibly damaging Het
Atr T A 9: 95,865,045 C127S probably benign Het
Auts2 A T 5: 131,451,893 S255T Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Cacnb1 A G 11: 98,005,133 L443P probably damaging Het
Cbfa2t3 G A 8: 122,638,144 Q300* probably null Het
Ccer1 A T 10: 97,694,339 D288V unknown Het
Col18a1 G A 10: 77,072,965 P611S probably benign Het
Cpa6 T A 1: 10,337,469 D281V possibly damaging Het
Cyp2e1 A G 7: 140,770,137 Y245C probably damaging Het
Cyp4a31 T C 4: 115,574,766 probably null Het
Entpd1 T C 19: 40,724,986 Y188H probably damaging Het
Epb42 T C 2: 121,033,362 D111G probably benign Het
Espl1 A G 15: 102,324,049 D2064G probably damaging Het
Fat3 A C 9: 15,996,864 V2614G probably damaging Het
Fos A T 12: 85,474,157 M40L probably benign Het
Frmd4b T A 6: 97,306,746 E434V probably damaging Het
Galnt6 A T 15: 100,693,464 D586E probably benign Het
Gapvd1 T C 2: 34,725,063 K474R probably damaging Het
Gimap8 T A 6: 48,656,188 F314I probably damaging Het
Gm10696 A G 3: 94,176,219 I95T probably benign Het
Gm11639 T A 11: 104,699,140 probably null Het
Gm14393 T G 2: 175,061,783 K110N probably damaging Het
Gm4131 C A 14: 62,480,933 A75S probably damaging Het
Heatr6 G A 11: 83,777,241 V854I probably benign Het
Hic2 T A 16: 17,258,942 M545K possibly damaging Het
Ip6k1 A G 9: 108,045,662 Y331C probably damaging Het
Kalrn C T 16: 34,212,157 probably null Het
Kxd1 T C 8: 70,515,434 K88E probably damaging Het
Lrrc37a A C 11: 103,502,856 V581G probably benign Het
Mex3d A T 10: 80,386,750 V224E Het
Mtx2 T A 2: 74,876,418 C246S probably damaging Het
Mybbp1a A G 11: 72,447,642 probably null Het
Myh6 A G 14: 54,960,307 I458T probably benign Het
Ndufs6 A G 13: 73,320,292 V96A possibly damaging Het
Nemf A T 12: 69,316,741 probably null Het
Notch1 T C 2: 26,459,938 S2397G probably benign Het
Olfr1229 A G 2: 89,282,860 I91T probably damaging Het
Olfr522 T C 7: 140,162,084 I289V probably benign Het
Osbpl1a T C 18: 12,768,592 E619G probably benign Het
Pfkl T C 10: 78,001,455 R95G probably benign Het
Plat T A 8: 22,778,505 I391K possibly damaging Het
Ppp1r21 A G 17: 88,554,886 H244R probably damaging Het
Rapgef3 G C 15: 97,753,877 H578Q probably benign Het
Rnf145 C A 11: 44,524,995 N12K probably damaging Het
Sfxn5 C T 6: 85,332,423 C100Y unknown Het
Sh3rf1 T A 8: 61,372,714 L581Q possibly damaging Het
Stard9 C A 2: 120,701,314 T2684N probably benign Het
Stard9 A C 2: 120,704,542 Q3760P probably benign Het
Stpg2 A G 3: 139,215,295 E87G probably benign Het
Syne2 A G 12: 76,059,457 Q792R possibly damaging Het
Taf7 T C 18: 37,642,548 D322G possibly damaging Het
Tbc1d1 A G 5: 64,173,813 S112G possibly damaging Het
Tbx3 A G 5: 119,672,028 M5V possibly damaging Het
Tmem45b A T 9: 31,428,032 I215N possibly damaging Het
Tpd52 G A 3: 8,963,856 Q43* probably null Het
Trpa1 T A 1: 14,882,233 N858I possibly damaging Het
Ttc30b C T 2: 75,938,061 R116H possibly damaging Het
Ttll5 A G 12: 85,925,764 D767G probably damaging Het
Vmn2r3 G A 3: 64,287,311 T62I probably benign Het
Wdr59 A T 8: 111,458,735 N874K Het
Other mutations in Sipa1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Sipa1l2 APN 8 125491806 missense probably damaging 1.00
IGL00939:Sipa1l2 APN 8 125464435 splice site probably benign
IGL00965:Sipa1l2 APN 8 125447874 missense probably benign 0.02
IGL01321:Sipa1l2 APN 8 125491518 missense probably damaging 1.00
IGL01450:Sipa1l2 APN 8 125422577 critical splice donor site probably null
IGL01753:Sipa1l2 APN 8 125453292 splice site probably benign
IGL01930:Sipa1l2 APN 8 125419239 missense probably damaging 0.99
IGL02041:Sipa1l2 APN 8 125491819 missense probably benign 0.03
IGL02215:Sipa1l2 APN 8 125447837 missense possibly damaging 0.67
IGL02272:Sipa1l2 APN 8 125492011 missense probably damaging 1.00
IGL02370:Sipa1l2 APN 8 125480269 missense probably damaging 1.00
IGL02538:Sipa1l2 APN 8 125451977 missense probably damaging 1.00
IGL02633:Sipa1l2 APN 8 125447768 missense probably damaging 1.00
IGL03394:Sipa1l2 APN 8 125491659 missense possibly damaging 0.67
rebellious UTSW 8 125468339 missense probably benign 0.01
R0144:Sipa1l2 UTSW 8 125449876 splice site probably null
R0153:Sipa1l2 UTSW 8 125421898 missense probably damaging 0.99
R0276:Sipa1l2 UTSW 8 125421940 missense probably damaging 1.00
R0318:Sipa1l2 UTSW 8 125447697 missense possibly damaging 0.73
R0373:Sipa1l2 UTSW 8 125464410 missense probably damaging 0.99
R0427:Sipa1l2 UTSW 8 125480332 missense probably damaging 1.00
R0634:Sipa1l2 UTSW 8 125422624 nonsense probably null
R1377:Sipa1l2 UTSW 8 125491977 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1435:Sipa1l2 UTSW 8 125468725 missense probably damaging 1.00
R1523:Sipa1l2 UTSW 8 125447613 missense possibly damaging 0.75
R1577:Sipa1l2 UTSW 8 125492262 missense probably benign 0.00
R1581:Sipa1l2 UTSW 8 125491617 missense probably damaging 0.96
R1583:Sipa1l2 UTSW 8 125421895 missense probably damaging 0.97
R1719:Sipa1l2 UTSW 8 125444535 missense probably damaging 0.99
R1730:Sipa1l2 UTSW 8 125480141 splice site probably null
R1940:Sipa1l2 UTSW 8 125480148 splice site probably benign
R2007:Sipa1l2 UTSW 8 125439437 missense probably damaging 1.00
R2141:Sipa1l2 UTSW 8 125491491 missense probably benign 0.07
R2203:Sipa1l2 UTSW 8 125491627 missense probably damaging 0.99
R2764:Sipa1l2 UTSW 8 125492374 missense probably damaging 0.99
R3722:Sipa1l2 UTSW 8 125473584 missense probably damaging 1.00
R3787:Sipa1l2 UTSW 8 125423205 missense probably benign
R3787:Sipa1l2 UTSW 8 125450383 missense possibly damaging 0.52
R4106:Sipa1l2 UTSW 8 125492308 missense probably damaging 1.00
R4117:Sipa1l2 UTSW 8 125468510 missense probably damaging 1.00
R4194:Sipa1l2 UTSW 8 125491672 missense probably benign 0.00
R4237:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4240:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4448:Sipa1l2 UTSW 8 125492355 missense probably damaging 1.00
R4515:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4519:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4523:Sipa1l2 UTSW 8 125492424 missense probably damaging 1.00
R4557:Sipa1l2 UTSW 8 125464415 missense probably damaging 0.98
R4667:Sipa1l2 UTSW 8 125453470 missense possibly damaging 0.93
R4687:Sipa1l2 UTSW 8 125491245 missense probably damaging 1.00
R4854:Sipa1l2 UTSW 8 125473601 missense probably damaging 1.00
R4890:Sipa1l2 UTSW 8 125491867 missense probably damaging 1.00
R5065:Sipa1l2 UTSW 8 125491585 missense probably benign 0.19
R5194:Sipa1l2 UTSW 8 125439273 missense possibly damaging 0.48
R5266:Sipa1l2 UTSW 8 125492126 missense probably damaging 0.99
R5475:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R5718:Sipa1l2 UTSW 8 125491248 missense probably damaging 1.00
R5910:Sipa1l2 UTSW 8 125491684 missense probably benign 0.42
R5916:Sipa1l2 UTSW 8 125468573 missense probably damaging 1.00
R5941:Sipa1l2 UTSW 8 125473536 missense probably damaging 0.99
R6083:Sipa1l2 UTSW 8 125468473 missense possibly damaging 0.87
R6185:Sipa1l2 UTSW 8 125468253 nonsense probably null
R6235:Sipa1l2 UTSW 8 125474871 missense probably damaging 1.00
R6274:Sipa1l2 UTSW 8 125469872 missense probably damaging 1.00
R6299:Sipa1l2 UTSW 8 125453464 missense possibly damaging 0.75
R6374:Sipa1l2 UTSW 8 125444630 missense probably damaging 1.00
R6459:Sipa1l2 UTSW 8 125444484 critical splice donor site probably null
R6462:Sipa1l2 UTSW 8 125491230 missense probably damaging 1.00
R6496:Sipa1l2 UTSW 8 125449894 missense probably benign 0.00
R6543:Sipa1l2 UTSW 8 125450362 missense possibly damaging 0.50
R7192:Sipa1l2 UTSW 8 125422609 missense probably benign 0.09
R7240:Sipa1l2 UTSW 8 125469860 missense probably damaging 1.00
R7361:Sipa1l2 UTSW 8 125453332 missense probably damaging 1.00
R7383:Sipa1l2 UTSW 8 125447646 missense probably damaging 1.00
X0027:Sipa1l2 UTSW 8 125492136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGACACACGCCATACTTACTAG -3'
(R):5'- GCCGAGAACTTTGTCACAACC -3'

Sequencing Primer
(F):5'- ACGCCATACTTACTAGCAGTCGTTG -3'
(R):5'- GTGGACACTTCTGCAAAATTCAGC -3'
Posted On2019-06-26