Incidental Mutation 'R7154:Pfkl'
ID557156
Institutional Source Beutler Lab
Gene Symbol Pfkl
Ensembl Gene ENSMUSG00000020277
Gene Namephosphofructokinase, liver, B-type
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7154 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location77986947-78010083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78001455 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 95 (R95G)
Ref Sequence ENSEMBL: ENSMUSP00000020522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020522] [ENSMUST00000145716] [ENSMUST00000218383]
Predicted Effect probably benign
Transcript: ENSMUST00000020522
AA Change: R95G

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020522
Gene: ENSMUSG00000020277
AA Change: R95G

DomainStartEndE-ValueType
Pfam:PFK 17 324 4.7e-109 PFAM
Pfam:PFK 401 686 1.9e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145716
AA Change: R66G

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000218383
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the liver (L) subunit of an enzyme that catalyzes the conversion of D-fructose 6-phosphate to D-fructose 1,6-bisphosphate, which is a key step in glucose metabolism (glycolysis). This enzyme is a tetramer that may be composed of different subunits encoded by distinct genes in different tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Adgre1 G A 17: 57,444,087 probably null Het
Agap2 A G 10: 127,091,655 D1135G probably benign Het
Akp3 T C 1: 87,125,224 L45P probably damaging Het
Arfgap3 A T 15: 83,336,704 W71R probably damaging Het
Asic3 G A 5: 24,413,662 probably benign Het
Asph A T 4: 9,630,930 N139K possibly damaging Het
Atr T A 9: 95,865,045 C127S probably benign Het
Auts2 A T 5: 131,451,893 S255T Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Cacnb1 A G 11: 98,005,133 L443P probably damaging Het
Cbfa2t3 G A 8: 122,638,144 Q300* probably null Het
Ccer1 A T 10: 97,694,339 D288V unknown Het
Col18a1 G A 10: 77,072,965 P611S probably benign Het
Cpa6 T A 1: 10,337,469 D281V possibly damaging Het
Cyp2e1 A G 7: 140,770,137 Y245C probably damaging Het
Cyp4a31 T C 4: 115,574,766 probably null Het
Entpd1 T C 19: 40,724,986 Y188H probably damaging Het
Epb42 T C 2: 121,033,362 D111G probably benign Het
Espl1 A G 15: 102,324,049 D2064G probably damaging Het
Fat3 A C 9: 15,996,864 V2614G probably damaging Het
Fos A T 12: 85,474,157 M40L probably benign Het
Frmd4b T A 6: 97,306,746 E434V probably damaging Het
Galnt6 A T 15: 100,693,464 D586E probably benign Het
Gapvd1 T C 2: 34,725,063 K474R probably damaging Het
Gimap8 T A 6: 48,656,188 F314I probably damaging Het
Gm10696 A G 3: 94,176,219 I95T probably benign Het
Gm11639 T A 11: 104,699,140 probably null Het
Gm14393 T G 2: 175,061,783 K110N probably damaging Het
Gm4131 C A 14: 62,480,933 A75S probably damaging Het
Heatr6 G A 11: 83,777,241 V854I probably benign Het
Hic2 T A 16: 17,258,942 M545K possibly damaging Het
Ip6k1 A G 9: 108,045,662 Y331C probably damaging Het
Kalrn C T 16: 34,212,157 probably null Het
Kxd1 T C 8: 70,515,434 K88E probably damaging Het
Lrrc37a A C 11: 103,502,856 V581G probably benign Het
Mex3d A T 10: 80,386,750 V224E Het
Mtx2 T A 2: 74,876,418 C246S probably damaging Het
Mybbp1a A G 11: 72,447,642 probably null Het
Myh6 A G 14: 54,960,307 I458T probably benign Het
Ndufs6 A G 13: 73,320,292 V96A possibly damaging Het
Nemf A T 12: 69,316,741 probably null Het
Notch1 T C 2: 26,459,938 S2397G probably benign Het
Olfr1229 A G 2: 89,282,860 I91T probably damaging Het
Olfr522 T C 7: 140,162,084 I289V probably benign Het
Osbpl1a T C 18: 12,768,592 E619G probably benign Het
Plat T A 8: 22,778,505 I391K possibly damaging Het
Ppp1r21 A G 17: 88,554,886 H244R probably damaging Het
Rapgef3 G C 15: 97,753,877 H578Q probably benign Het
Rnf145 C A 11: 44,524,995 N12K probably damaging Het
Sfxn5 C T 6: 85,332,423 C100Y unknown Het
Sh3rf1 T A 8: 61,372,714 L581Q possibly damaging Het
Sipa1l2 T C 8: 125,468,339 K887E probably benign Het
Stard9 C A 2: 120,701,314 T2684N probably benign Het
Stard9 A C 2: 120,704,542 Q3760P probably benign Het
Stpg2 A G 3: 139,215,295 E87G probably benign Het
Syne2 A G 12: 76,059,457 Q792R possibly damaging Het
Taf7 T C 18: 37,642,548 D322G possibly damaging Het
Tbc1d1 A G 5: 64,173,813 S112G possibly damaging Het
Tbx3 A G 5: 119,672,028 M5V possibly damaging Het
Tmem45b A T 9: 31,428,032 I215N possibly damaging Het
Tpd52 G A 3: 8,963,856 Q43* probably null Het
Trpa1 T A 1: 14,882,233 N858I possibly damaging Het
Ttc30b C T 2: 75,938,061 R116H possibly damaging Het
Ttll5 A G 12: 85,925,764 D767G probably damaging Het
Vmn2r3 G A 3: 64,287,311 T62I probably benign Het
Wdr59 A T 8: 111,458,735 N874K Het
Other mutations in Pfkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Pfkl APN 10 77991395 missense probably benign
IGL01759:Pfkl APN 10 78000731 missense probably damaging 1.00
IGL02697:Pfkl APN 10 77999918 missense probably benign 0.09
IGL02870:Pfkl APN 10 78000839 nonsense probably null
IGL02942:Pfkl APN 10 78000133 critical splice donor site probably null
IGL02972:Pfkl APN 10 77988274 missense probably benign 0.00
IGL03342:Pfkl APN 10 78005475 missense possibly damaging 0.95
ANU23:Pfkl UTSW 10 77991395 missense probably benign
R0226:Pfkl UTSW 10 77992534 missense probably benign 0.00
R0743:Pfkl UTSW 10 77995243 critical splice donor site probably null
R0899:Pfkl UTSW 10 78005439 critical splice donor site probably null
R0926:Pfkl UTSW 10 78000689 missense probably damaging 1.00
R1264:Pfkl UTSW 10 77993416 missense possibly damaging 0.46
R1782:Pfkl UTSW 10 77988720 missense probably benign 0.00
R1918:Pfkl UTSW 10 78001426 missense probably damaging 1.00
R3743:Pfkl UTSW 10 77996345 missense probably damaging 1.00
R4559:Pfkl UTSW 10 77988883 missense probably benign 0.00
R4804:Pfkl UTSW 10 77991394 missense probably benign
R4823:Pfkl UTSW 10 77997594 missense probably damaging 1.00
R4906:Pfkl UTSW 10 77988310 missense probably damaging 1.00
R5082:Pfkl UTSW 10 77996408 missense probably damaging 1.00
R5216:Pfkl UTSW 10 78009670 missense probably damaging 0.99
R5380:Pfkl UTSW 10 77997589 missense possibly damaging 0.86
R5816:Pfkl UTSW 10 78002022 missense possibly damaging 0.75
R5840:Pfkl UTSW 10 77988724 missense probably benign
R5888:Pfkl UTSW 10 77991370 missense possibly damaging 0.68
R6143:Pfkl UTSW 10 77989613 missense probably damaging 0.96
R6152:Pfkl UTSW 10 77990151 missense probably benign 0.00
R6251:Pfkl UTSW 10 77989565 critical splice donor site probably null
R6262:Pfkl UTSW 10 77988673 critical splice donor site probably null
R6382:Pfkl UTSW 10 77999837 missense probably damaging 0.98
R6407:Pfkl UTSW 10 77988673 critical splice donor site probably null
R6547:Pfkl UTSW 10 77995354 missense probably benign
R6704:Pfkl UTSW 10 77996366 missense probably damaging 1.00
R6996:Pfkl UTSW 10 77997589 missense probably damaging 1.00
R7116:Pfkl UTSW 10 78001415 missense probably benign
R7183:Pfkl UTSW 10 78002082 nonsense probably null
R7248:Pfkl UTSW 10 77989589 missense probably damaging 1.00
R7252:Pfkl UTSW 10 77993429 missense probably damaging 1.00
R7278:Pfkl UTSW 10 77992023 missense probably damaging 0.99
X0026:Pfkl UTSW 10 77989643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGACCTTATGACCTGCAG -3'
(R):5'- AGATTCTAGAGGCTTCTCCCC -3'

Sequencing Primer
(F):5'- TGACCTTATGACCTGCAGACTATAC -3'
(R):5'- CTCCCCTGTTTAATTCTGTGGGG -3'
Posted On2019-06-26