Incidental Mutation 'R7155:Lhx8'
ID557201
Institutional Source Beutler Lab
Gene Symbol Lhx8
Ensembl Gene ENSMUSG00000096225
Gene NameLIM homeobox protein 8
SynonymsL3, Lhx7
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R7155 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location154306294-154330659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 154324584 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 137 (Y137F)
Ref Sequence ENSEMBL: ENSMUSP00000136047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177846] [ENSMUST00000204171] [ENSMUST00000204403] [ENSMUST00000205251]
Predicted Effect possibly damaging
Transcript: ENSMUST00000177846
AA Change: Y137F

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136047
Gene: ENSMUSG00000096225
AA Change: Y137F

DomainStartEndE-ValueType
low complexity region 67 87 N/A INTRINSIC
LIM 95 148 2.38e-12 SMART
LIM 156 210 2.06e-16 SMART
HOX 246 308 2.7e-23 SMART
low complexity region 310 321 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000204171
SMART Domains Protein: ENSMUSP00000144708
Gene: ENSMUSG00000096225

DomainStartEndE-ValueType
low complexity region 11 31 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000204403
AA Change: Y106F

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145516
Gene: ENSMUSG00000096225
AA Change: Y106F

DomainStartEndE-ValueType
low complexity region 36 56 N/A INTRINSIC
LIM 64 117 2.38e-12 SMART
LIM 125 179 2.06e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205251
AA Change: Y106F

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145485
Gene: ENSMUSG00000096225
AA Change: Y106F

DomainStartEndE-ValueType
low complexity region 36 56 N/A INTRINSIC
LIM 64 117 2.38e-12 SMART
LIM 125 179 2.06e-16 SMART
HOX 215 277 2.7e-23 SMART
low complexity region 279 290 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LIM homeobox family of proteins, which are involved in patterning and differentiation of various tissue types. These proteins contain two tandemly repeated cysteine-rich double-zinc finger motifs known as LIM domains, in addition to a DNA-binding homeodomain. This family member is a transcription factor that plays a role in tooth morphogenesis. It is also involved in oogenesis and in neuronal differentiation. This gene is a candidate gene for cleft palate, and it is also associated with odontoma formation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice exhibit partial penetrance of a cleft secondary palate and neonatal lethality; those without cleft palate survive to adulthood. All homozygous null mice have decreased or absent forebrain cholinergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,569 L63P possibly damaging Het
Abca13 A T 11: 9,529,010 Y4286F probably benign Het
Aldh5a1 A C 13: 24,911,589 V515G possibly damaging Het
Ankrd42 T C 7: 92,591,933 E406G possibly damaging Het
Arfgef2 T A 2: 166,865,813 M1043K probably benign Het
Arhgef11 T A 3: 87,709,572 Y383* probably null Het
Aste1 C T 9: 105,405,136 P614L probably damaging Het
B3galt5 T A 16: 96,315,805 S213T probably damaging Het
Bak1 A G 17: 27,022,460 L108P possibly damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bdp1 T G 13: 100,061,151 T909P possibly damaging Het
Cacna1i A G 15: 80,395,238 H2060R probably benign Het
Cdhr3 G T 12: 33,061,773 P246Q probably damaging Het
Colgalt1 T C 8: 71,623,710 S602P probably damaging Het
Csde1 T C 3: 103,039,953 S74P probably damaging Het
Cyp51 A T 5: 4,087,846 C366S possibly damaging Het
Dcaf7 A G 11: 106,037,190 N23D probably damaging Het
Ddx10 G A 9: 53,117,288 A772V probably benign Het
Ddx4 A G 13: 112,613,785 F404S probably benign Het
Dirc2 G T 16: 35,735,577 T171K probably benign Het
Dlg4 T A 11: 70,017,216 M1K probably null Het
Dnajc6 T C 4: 101,612,945 V293A probably damaging Het
Etl4 G T 2: 20,806,931 R1643L probably damaging Het
F13b G A 1: 139,508,157 E234K probably damaging Het
Fam171a1 T C 2: 3,225,729 I633T probably benign Het
Frem3 A G 8: 80,616,039 I1654V probably benign Het
Galr2 A G 11: 116,283,582 E346G possibly damaging Het
Gck G A 11: 5,949,705 probably benign Het
Gen1 G T 12: 11,241,832 T717K probably benign Het
Gm13083 A T 4: 143,616,165 I281F probably benign Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Hat1 A G 2: 71,421,251 T215A possibly damaging Het
Hmbox1 A T 14: 64,897,037 M38K probably damaging Het
Ifi47 A G 11: 49,096,542 K379E probably benign Het
Ift81 T C 5: 122,568,999 Y460C probably damaging Het
Jarid2 T A 13: 44,902,462 S381R probably damaging Het
Kmt2b A T 7: 30,579,963 V1458E probably damaging Het
Kpna4 G T 3: 69,089,933 P336Q probably damaging Het
Krt84 T C 15: 101,532,254 R168G probably damaging Het
Lin7b T C 7: 45,370,227 E19G probably damaging Het
Lrmda A T 14: 22,584,540 R131S probably damaging Het
Lrrc75b C T 10: 75,553,678 A280T possibly damaging Het
Megf11 G A 9: 64,647,951 R268K probably null Het
Mgat4e G T 1: 134,541,959 Q116K probably damaging Het
Mlkl A G 8: 111,319,403 L325P probably damaging Het
Mup2 A G 4: 60,137,641 L134P probably damaging Het
Myo19 A G 11: 84,900,586 E489G probably damaging Het
Ncbp3 C A 11: 73,048,009 P37Q probably damaging Het
Nf2 A G 11: 4,799,964 V236A probably damaging Het
Nlrp1a A T 11: 71,124,079 M115K possibly damaging Het
Nsf T A 11: 103,828,530 K649* probably null Het
Olfml2b A T 1: 170,666,785 I313L probably benign Het
Olfr316 T A 11: 58,758,283 I206N probably damaging Het
Olfr654 T A 7: 104,588,557 V251D possibly damaging Het
Papln T A 12: 83,776,521 L444Q probably damaging Het
Phc3 T C 3: 30,914,197 I897V probably benign Het
Plcg1 T C 2: 160,754,380 L632P probably damaging Het
Prkg1 T C 19: 31,302,301 T178A probably damaging Het
Ptges T A 2: 30,892,804 T79S probably benign Het
Rab26 T C 17: 24,532,289 T81A probably damaging Het
Rai14 T A 15: 10,595,003 I145L possibly damaging Het
Rasgrf1 A G 9: 90,002,361 T960A possibly damaging Het
Rfx1 A T 8: 84,094,826 I755F probably damaging Het
Rims1 T G 1: 22,432,923 L670F probably damaging Het
Rtkn G A 6: 83,149,711 C297Y probably damaging Het
Sec23a A T 12: 58,989,443 N378K probably benign Het
Slc17a2 A G 13: 23,822,407 E472G probably benign Het
Slc1a2 T C 2: 102,766,995 M449T probably damaging Het
Slc22a3 G A 17: 12,433,631 L369F possibly damaging Het
Smad6 G T 9: 64,021,787 D82E unknown Het
Smgc A T 15: 91,852,608 I463F possibly damaging Het
Strada C A 11: 106,171,039 G166C probably damaging Het
Tcaf3 A G 6: 42,593,891 V309A probably benign Het
Tet2 C T 3: 133,469,591 E1332K possibly damaging Het
Tfcp2l1 A G 1: 118,668,632 N366D probably damaging Het
Tll2 G A 19: 41,117,284 P369L possibly damaging Het
Tox4 T C 14: 52,292,097 V505A probably benign Het
Trbv4 A G 6: 41,059,853 D104G probably damaging Het
Ugdh T C 5: 65,417,037 E416G probably damaging Het
Usp47 T A 7: 112,087,013 C613S probably damaging Het
Vmn1r11 T A 6: 57,138,162 N270K probably benign Het
Wsb2 T A 5: 117,371,095 L147Q probably damaging Het
Xrn1 G A 9: 95,979,145 A453T possibly damaging Het
Zan A G 5: 137,461,844 S1262P unknown Het
Zswim4 A G 8: 84,219,927 L700P probably damaging Het
Other mutations in Lhx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01806:Lhx8 APN 3 154322355 missense probably damaging 1.00
IGL01991:Lhx8 APN 3 154324554 missense probably damaging 1.00
R0463:Lhx8 UTSW 3 154328171 splice site probably null
R1449:Lhx8 UTSW 3 154328105 nonsense probably null
R1837:Lhx8 UTSW 3 154328055 missense possibly damaging 0.94
R2272:Lhx8 UTSW 3 154316762 missense probably damaging 1.00
R3196:Lhx8 UTSW 3 154330288 missense probably benign 0.05
R4900:Lhx8 UTSW 3 154330288 missense probably benign 0.01
R5120:Lhx8 UTSW 3 154311695 missense probably damaging 0.99
R5223:Lhx8 UTSW 3 154321644 missense probably damaging 1.00
R5587:Lhx8 UTSW 3 154311679 missense probably damaging 0.99
R6046:Lhx8 UTSW 3 154321703 missense probably damaging 1.00
X0028:Lhx8 UTSW 3 154324575 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TAAGAGGTTGACCCTGATGCTG -3'
(R):5'- ATGCACGCTCATGTCAAGG -3'

Sequencing Primer
(F):5'- AGGTTGACCCTGATGCTGAAACC -3'
(R):5'- CGCTCATGTCAAGGGTGCTG -3'
Posted On2019-06-26