Incidental Mutation 'R7157:Bicdl1'
ID557366
Institutional Source Beutler Lab
Gene Symbol Bicdl1
Ensembl Gene ENSMUSG00000041609
Gene NameBICD family like cargo adaptor 1
Synonyms2210403N09Rik, Ccdc64, BICDR-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R7157 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location115648175-115731621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 115651857 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 511 (Q511K)
Ref Sequence ENSEMBL: ENSMUSP00000053547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031492] [ENSMUST00000055408] [ENSMUST00000118576] [ENSMUST00000121746] [ENSMUST00000141976] [ENSMUST00000148276]
Predicted Effect probably benign
Transcript: ENSMUST00000031492
SMART Domains Protein: ENSMUSP00000031492
Gene: ENSMUSG00000029518

DomainStartEndE-ValueType
RAB 9 171 5.07e-89 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000055408
AA Change: Q511K

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053547
Gene: ENSMUSG00000041609
AA Change: Q511K

DomainStartEndE-ValueType
low complexity region 47 68 N/A INTRINSIC
Pfam:HAP1_N 97 162 2e-11 PFAM
low complexity region 305 316 N/A INTRINSIC
low complexity region 336 374 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
coiled coil region 467 529 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118576
AA Change: Q16K

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112842
Gene: ENSMUSG00000041609
AA Change: Q16K

DomainStartEndE-ValueType
coiled coil region 5 34 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121746
AA Change: Q16K

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112949
Gene: ENSMUSG00000041609
AA Change: Q16K

DomainStartEndE-ValueType
coiled coil region 5 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141976
AA Change: Q16K

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000148276
AA Change: Q290K

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119664
Gene: ENSMUSG00000041609
AA Change: Q290K

DomainStartEndE-ValueType
coiled coil region 1 110 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
coiled coil region 178 284 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,976 G701D probably damaging Het
6030468B19Rik T A 11: 117,802,954 N82K probably damaging Het
Abca17 A T 17: 24,335,590 V130E possibly damaging Het
Alpk2 T A 18: 65,266,277 K2077* probably null Het
Aox2 T C 1: 58,283,492 F73S probably benign Het
Ap3b1 T A 13: 94,532,034 C965* probably null Het
Arhgef10 T A 8: 14,930,030 V90E probably damaging Het
Atp5s A T 12: 69,741,788 N154Y probably benign Het
Atr T A 9: 95,869,900 H523Q probably benign Het
Capn15 A T 17: 25,965,254 N150K probably damaging Het
Card6 A T 15: 5,100,109 W602R probably benign Het
Clnk A T 5: 38,769,891 S82T possibly damaging Het
Cmah T C 13: 24,436,629 I282T probably damaging Het
Cog8 A G 8: 107,052,499 I382T probably benign Het
Dhrs7c G T 11: 67,809,896 probably null Het
Dhrs9 T A 2: 69,393,158 D83E probably damaging Het
Dmgdh G A 13: 93,715,535 G624E probably damaging Het
Dnajc30 C A 5: 135,064,715 F155L probably damaging Het
Drc7 A C 8: 95,074,150 K600T probably damaging Het
Efhb A C 17: 53,400,900 I745S probably damaging Het
Fasn T A 11: 120,810,465 K1988* probably null Het
Gad2 T C 2: 22,635,023 L273P probably damaging Het
Gm45861 A T 8: 27,542,508 K887* probably null Het
Gm45861 A T 8: 27,542,509 K887I unknown Het
Gm9195 A G 14: 72,480,781 Y152H probably damaging Het
Grip1 G A 10: 119,945,156 D237N probably damaging Het
Hamp A C 7: 30,942,536 C65G possibly damaging Het
Hes3 A G 4: 152,288,124 probably benign Het
Hgh1 T C 15: 76,370,450 I342T probably damaging Het
Hlcs T A 16: 94,268,164 K66* probably null Het
Ift80 A T 3: 68,990,944 C19* probably null Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kbtbd12 C T 6: 88,618,668 C60Y probably damaging Het
Kdm4c T A 4: 74,345,567 V696E probably benign Het
Lect2 A G 13: 56,542,990 I117T unknown Het
Lipn T A 19: 34,076,990 Y209* probably null Het
Lpin3 G A 2: 160,898,707 V391I probably benign Het
Mocs2 A T 13: 114,824,607 I47L probably benign Het
Mogs T A 6: 83,118,507 H768Q probably benign Het
Nbeal1 T A 1: 60,237,158 I686N probably damaging Het
Nbeal1 T A 1: 60,260,634 C1376* probably null Het
Ninl A G 2: 150,949,343 Y1087H possibly damaging Het
Olfr1076 T A 2: 86,509,025 C189S probably damaging Het
Olfr1338 A G 4: 118,754,418 V42A possibly damaging Het
Olfr518 A G 7: 108,881,268 F113L probably benign Het
Olfr623 A C 7: 103,660,581 L223R probably damaging Het
Olfr729 A G 14: 50,148,232 L214S probably damaging Het
Olfr750 A G 14: 51,071,159 V78A possibly damaging Het
Pkn1 A G 8: 83,671,734 F768S probably damaging Het
Plekha2 A G 8: 25,063,941 F82L probably damaging Het
Ppie T C 4: 123,135,107 E111G probably benign Het
Rps6ka5 T C 12: 100,581,420 Y277C probably damaging Het
Scgb2b12 A G 7: 32,326,677 V30A probably benign Het
Serac1 A T 17: 6,074,201 S16T probably benign Het
Sf3a3 T C 4: 124,722,900 Y192H probably damaging Het
Slc14a1 A G 18: 78,102,411 V436A probably benign Het
Smc3 T A 19: 53,641,898 M1112K probably damaging Het
Tnk2 G A 16: 32,681,168 G1017E probably damaging Het
Tnn T A 1: 160,126,377 K603* probably null Het
Trpm6 T C 19: 18,838,098 S1183P possibly damaging Het
Ttn A T 2: 76,784,380 V16964E possibly damaging Het
Usp17le G A 7: 104,768,489 T482I probably benign Het
Vmn1r219 T A 13: 23,163,355 M238K probably damaging Het
Wfs1 C T 5: 36,967,172 G792S probably benign Het
Xpa A T 4: 46,185,612 L122Q probably damaging Het
Other mutations in Bicdl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Bicdl1 APN 5 115670156 nonsense probably null
IGL01902:Bicdl1 APN 5 115651874 missense probably damaging 1.00
IGL02416:Bicdl1 APN 5 115663885 missense probably damaging 1.00
IGL02417:Bicdl1 APN 5 115673158 missense probably damaging 1.00
IGL03088:Bicdl1 APN 5 115663822 missense possibly damaging 0.83
IGL03275:Bicdl1 APN 5 115731160 missense probably damaging 1.00
bargain UTSW 5 115670153 critical splice donor site probably null
R6807_Bicdl1_588 UTSW 5 115672143 critical splice donor site probably null
R0837:Bicdl1 UTSW 5 115731292 missense probably benign 0.06
R0924:Bicdl1 UTSW 5 115661528 splice site probably benign
R1581:Bicdl1 UTSW 5 115651267 unclassified probably benign
R1589:Bicdl1 UTSW 5 115651266 unclassified probably benign
R1669:Bicdl1 UTSW 5 115656016 missense possibly damaging 0.84
R2076:Bicdl1 UTSW 5 115655928 missense probably damaging 0.96
R2089:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R2091:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R2091:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R4772:Bicdl1 UTSW 5 115661478 missense probably benign 0.36
R6185:Bicdl1 UTSW 5 115670153 critical splice donor site probably null
R6807:Bicdl1 UTSW 5 115672143 critical splice donor site probably null
R7107:Bicdl1 UTSW 5 115670170 missense probably benign 0.03
R7205:Bicdl1 UTSW 5 115670281 missense probably damaging 1.00
R7485:Bicdl1 UTSW 5 115663786 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCGAATGAGCAGCTGAGTG -3'
(R):5'- CTTGAAGAAGCATAGCTCCAGG -3'

Sequencing Primer
(F):5'- TGGGGCCGACTCCACATC -3'
(R):5'- ATAGCTCCAGGGACCCTATG -3'
Posted On2019-06-26