Incidental Mutation 'R7157:Grip1'
ID557384
Institutional Source Beutler Lab
Gene Symbol Grip1
Ensembl Gene ENSMUSG00000034813
Gene Nameglutamate receptor interacting protein 1
Synonymseb
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7157 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location119453830-120087261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119945156 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 237 (D237N)
Ref Sequence ENSEMBL: ENSMUSP00000123234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041962] [ENSMUST00000077871] [ENSMUST00000105262] [ENSMUST00000138410] [ENSMUST00000144825] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000147454] [ENSMUST00000148954]
PDB Structure
Solution Structure of the PDZ Domain from Mouse Glutamate Receptor Interacting Protein 1A-L (GRIP1) Homolog [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000041962
AA Change: D238N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042436
Gene: ENSMUSG00000034813
AA Change: D238N

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 354 367 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
PDZ 429 509 6.36e-17 SMART
PDZ 530 606 1.11e-16 SMART
PDZ 629 703 1.73e-18 SMART
PDZ 947 1019 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077871
AA Change: D211N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077033
Gene: ENSMUSG00000034813
AA Change: D211N

DomainStartEndE-ValueType
PDZ 36 110 4.86e-13 SMART
PDZ 134 212 6.4e-22 SMART
PDZ 235 310 1.97e-13 SMART
low complexity region 327 340 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
PDZ 402 482 6.36e-17 SMART
PDZ 503 579 1.11e-16 SMART
PDZ 602 676 1.73e-18 SMART
PDZ 920 992 2.79e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105262
AA Change: D237N

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100897
Gene: ENSMUSG00000034813
AA Change: D237N

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 946 1018 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000138410
AA Change: D237N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123234
Gene: ENSMUSG00000034813
AA Change: D237N

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 1013 1085 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144825
AA Change: D210N

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121670
Gene: ENSMUSG00000034813
AA Change: D210N

DomainStartEndE-ValueType
PDZ 35 109 4.86e-13 SMART
PDZ 133 211 6.4e-22 SMART
PDZ 234 309 1.97e-13 SMART
low complexity region 326 339 N/A INTRINSIC
low complexity region 360 377 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
PDZ 401 481 6.36e-17 SMART
PDZ 502 578 1.11e-16 SMART
PDZ 601 675 1.73e-18 SMART
PDZ 919 991 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144959
AA Change: D237N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813
AA Change: D237N

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147356
AA Change: D238N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813
AA Change: D238N

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 394 422 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
PDZ 481 561 6.36e-17 SMART
PDZ 582 658 1.11e-16 SMART
PDZ 681 755 1.73e-18 SMART
PDZ 999 1071 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147454
AA Change: D237N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118073
Gene: ENSMUSG00000034813
AA Change: D237N

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000148954
AA Change: D237N

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118397
Gene: ENSMUSG00000034813
AA Change: D237N

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 961 1033 2.79e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing multiple PDZ (post synaptic density protein, Drosophila disc large tumor suppressor, and zonula occludens-1 protein) domains. The encoded protein acts as a mediator between cytoskeletal and membrane proteins, particularly in neuronal cells, and facilitates complex formation at the cell membrane. Mutation of this gene can cause embryonic lethality resulting from defects of the dermo-epidermal junction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous ablation of gene function results in embryonic lethality and blistering skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,976 G701D probably damaging Het
6030468B19Rik T A 11: 117,802,954 N82K probably damaging Het
Abca17 A T 17: 24,335,590 V130E possibly damaging Het
Alpk2 T A 18: 65,266,277 K2077* probably null Het
Aox2 T C 1: 58,283,492 F73S probably benign Het
Ap3b1 T A 13: 94,532,034 C965* probably null Het
Arhgef10 T A 8: 14,930,030 V90E probably damaging Het
Atp5s A T 12: 69,741,788 N154Y probably benign Het
Atr T A 9: 95,869,900 H523Q probably benign Het
Bicdl1 G T 5: 115,651,857 Q511K possibly damaging Het
Capn15 A T 17: 25,965,254 N150K probably damaging Het
Card6 A T 15: 5,100,109 W602R probably benign Het
Clnk A T 5: 38,769,891 S82T possibly damaging Het
Cmah T C 13: 24,436,629 I282T probably damaging Het
Cog8 A G 8: 107,052,499 I382T probably benign Het
Dhrs7c G T 11: 67,809,896 probably null Het
Dhrs9 T A 2: 69,393,158 D83E probably damaging Het
Dmgdh G A 13: 93,715,535 G624E probably damaging Het
Dnajc30 C A 5: 135,064,715 F155L probably damaging Het
Drc7 A C 8: 95,074,150 K600T probably damaging Het
Efhb A C 17: 53,400,900 I745S probably damaging Het
Fasn T A 11: 120,810,465 K1988* probably null Het
Gad2 T C 2: 22,635,023 L273P probably damaging Het
Gm45861 A T 8: 27,542,508 K887* probably null Het
Gm45861 A T 8: 27,542,509 K887I unknown Het
Gm9195 A G 14: 72,480,781 Y152H probably damaging Het
Hamp A C 7: 30,942,536 C65G possibly damaging Het
Hes3 A G 4: 152,288,124 probably benign Het
Hgh1 T C 15: 76,370,450 I342T probably damaging Het
Hlcs T A 16: 94,268,164 K66* probably null Het
Ift80 A T 3: 68,990,944 C19* probably null Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kbtbd12 C T 6: 88,618,668 C60Y probably damaging Het
Kdm4c T A 4: 74,345,567 V696E probably benign Het
Lect2 A G 13: 56,542,990 I117T unknown Het
Lipn T A 19: 34,076,990 Y209* probably null Het
Lpin3 G A 2: 160,898,707 V391I probably benign Het
Mocs2 A T 13: 114,824,607 I47L probably benign Het
Mogs T A 6: 83,118,507 H768Q probably benign Het
Nbeal1 T A 1: 60,237,158 I686N probably damaging Het
Nbeal1 T A 1: 60,260,634 C1376* probably null Het
Ninl A G 2: 150,949,343 Y1087H possibly damaging Het
Olfr1076 T A 2: 86,509,025 C189S probably damaging Het
Olfr1338 A G 4: 118,754,418 V42A possibly damaging Het
Olfr518 A G 7: 108,881,268 F113L probably benign Het
Olfr623 A C 7: 103,660,581 L223R probably damaging Het
Olfr729 A G 14: 50,148,232 L214S probably damaging Het
Olfr750 A G 14: 51,071,159 V78A possibly damaging Het
Pkn1 A G 8: 83,671,734 F768S probably damaging Het
Plekha2 A G 8: 25,063,941 F82L probably damaging Het
Ppie T C 4: 123,135,107 E111G probably benign Het
Rps6ka5 T C 12: 100,581,420 Y277C probably damaging Het
Scgb2b12 A G 7: 32,326,677 V30A probably benign Het
Serac1 A T 17: 6,074,201 S16T probably benign Het
Sf3a3 T C 4: 124,722,900 Y192H probably damaging Het
Slc14a1 A G 18: 78,102,411 V436A probably benign Het
Smc3 T A 19: 53,641,898 M1112K probably damaging Het
Tnk2 G A 16: 32,681,168 G1017E probably damaging Het
Tnn T A 1: 160,126,377 K603* probably null Het
Trpm6 T C 19: 18,838,098 S1183P possibly damaging Het
Ttn A T 2: 76,784,380 V16964E possibly damaging Het
Usp17le G A 7: 104,768,489 T482I probably benign Het
Vmn1r219 T A 13: 23,163,355 M238K probably damaging Het
Wfs1 C T 5: 36,967,172 G792S probably benign Het
Xpa A T 4: 46,185,612 L122Q probably damaging Het
Other mutations in Grip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Grip1 APN 10 119931302 nonsense probably null
IGL01374:Grip1 APN 10 120049368 missense probably benign 0.03
IGL01592:Grip1 APN 10 119930003 missense probably damaging 1.00
IGL02207:Grip1 APN 10 120075309 missense probably damaging 1.00
IGL02222:Grip1 APN 10 119999809 missense probably damaging 1.00
IGL02225:Grip1 APN 10 120049453 missense probably damaging 1.00
IGL02447:Grip1 APN 10 120020071 missense probably damaging 1.00
IGL02492:Grip1 APN 10 119930040 splice site probably benign
IGL02522:Grip1 APN 10 119931249 missense probably damaging 1.00
IGL02574:Grip1 APN 10 119942913 missense probably damaging 1.00
IGL02718:Grip1 APN 10 120075515 makesense probably null
IGL02751:Grip1 APN 10 119978577 missense probably benign 0.08
IGL03221:Grip1 APN 10 119986394 missense probably benign 0.00
IGL03377:Grip1 APN 10 120055032 missense probably damaging 0.98
PIT4403001:Grip1 UTSW 10 119929928 missense probably damaging 1.00
R0304:Grip1 UTSW 10 120075471 missense probably benign 0.31
R0681:Grip1 UTSW 10 120010230 missense probably damaging 1.00
R0760:Grip1 UTSW 10 120018078 missense probably damaging 0.96
R1457:Grip1 UTSW 10 119986350 missense possibly damaging 0.73
R1506:Grip1 UTSW 10 119978451 missense probably damaging 1.00
R1541:Grip1 UTSW 10 120000543 missense probably damaging 0.99
R1553:Grip1 UTSW 10 120054851 missense probably damaging 1.00
R1709:Grip1 UTSW 10 119897715 missense probably damaging 0.98
R2055:Grip1 UTSW 10 120049511 splice site probably benign
R2059:Grip1 UTSW 10 120038698 missense possibly damaging 0.80
R2261:Grip1 UTSW 10 119985584 missense probably benign 0.00
R2475:Grip1 UTSW 10 119978496 missense probably benign 0.01
R3777:Grip1 UTSW 10 119985630 critical splice donor site probably null
R3849:Grip1 UTSW 10 119929958 missense probably damaging 1.00
R3956:Grip1 UTSW 10 119930026 missense probably damaging 1.00
R4643:Grip1 UTSW 10 120020101 missense probably damaging 1.00
R4693:Grip1 UTSW 10 120000554 missense probably benign 0.10
R4724:Grip1 UTSW 10 120038683 missense probably benign 0.02
R4843:Grip1 UTSW 10 119930015 missense probably damaging 1.00
R4884:Grip1 UTSW 10 120075306 missense probably damaging 1.00
R4912:Grip1 UTSW 10 119931248 missense probably damaging 1.00
R5185:Grip1 UTSW 10 119931259 missense probably benign 0.37
R5291:Grip1 UTSW 10 120086969 missense probably benign 0.04
R5293:Grip1 UTSW 10 119897735 missense probably damaging 0.99
R5296:Grip1 UTSW 10 119929928 missense probably damaging 1.00
R5302:Grip1 UTSW 10 120020077 missense probably damaging 1.00
R5541:Grip1 UTSW 10 120072718 missense probably damaging 1.00
R5792:Grip1 UTSW 10 119985480 missense probably benign 0.07
R5861:Grip1 UTSW 10 119929970 missense probably damaging 1.00
R5905:Grip1 UTSW 10 119985492 missense probably benign 0.02
R5949:Grip1 UTSW 10 120050242 missense probably benign 0.00
R6112:Grip1 UTSW 10 119993232 missense probably benign 0.00
R6166:Grip1 UTSW 10 120072718 missense probably damaging 1.00
R6167:Grip1 UTSW 10 119897797 critical splice donor site probably null
R6193:Grip1 UTSW 10 120038314 missense probably damaging 1.00
R6218:Grip1 UTSW 10 119986346 missense possibly damaging 0.95
R6267:Grip1 UTSW 10 120075464 nonsense probably null
R6296:Grip1 UTSW 10 120075464 nonsense probably null
R6490:Grip1 UTSW 10 119986424 missense possibly damaging 0.82
R6543:Grip1 UTSW 10 119985594 missense probably benign 0.00
R6558:Grip1 UTSW 10 119454383 missense probably benign 0.00
R6995:Grip1 UTSW 10 119986470 missense probably damaging 0.99
R7122:Grip1 UTSW 10 120035374 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TATTAAAGCTGAGCCCCATTACG -3'
(R):5'- AACCCTGGACACGAGAACTG -3'

Sequencing Primer
(F):5'- TGAGCCCCATTACGCTGAATTAATC -3'
(R):5'- CTGTGTGCCACTGAAAAGGACC -3'
Posted On2019-06-26